Morpholino

MO4-ptf1a

ID
ZDB-MRPHLNO-070531-9
Name
MO4-ptf1a
Previous Names
None
Target
Sequence
5' - TTGCCCAGTAACAACAATCGCCTAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-ptf1a
No data available
Phenotype
Phenotype resulting from MO4-ptf1a
No data available
Phenotype of all Fish created by or utilizing MO4-ptf1a
Phenotype Fish Conditions Figures
pancreatic B cell absent, abnormal jh4Tg/jh4Tg + MO1-ptf1a + MO4-ptf1a chemical treatment: metronidazole Fig. 6 from Pisharath et al., 2007
exocrine pancreas aplastic, abnormal jh4Tg/jh4Tg + MO1-ptf1a + MO4-ptf1a chemical treatment: metronidazole Fig. 6 from Pisharath et al., 2007
amacrine cell absent, abnormal ptf1asa126/sa126 + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
retinal inner plexiform layer decreased thickness, abnormal ptf1asa126/sa126 + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
retina ab1-elavl labeling absent, abnormal ptf1asa126/sa126; nns5Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 control Fig. 5 with image from Randlett et al., 2013
retinal ganglion cell absent, abnormal ptf1asa126/sa126; nns5Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 control Fig. 5 with image from Randlett et al., 2013
retinal inner plexiform layer decreased thickness, abnormal ptf1asa126/sa126; nns5Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
amacrine cell absent, abnormal ptf1asa126/sa126; nns5Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 control Fig. 5 with image from Randlett et al., 2013
Muller cell absent, abnormal ptf1asa126/sa126; nns5Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 control Fig. 5 with image from Randlett et al., 2013
retina ab1-elavl labeling absent, abnormal atoh7th241/th241; ptf1asa126/sa126; cu2Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 3 with image from Randlett et al., 2013
bipolar neuron postsynaptic density absent, abnormal atoh7th241/th241; ptf1asa126/sa126; cu2Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 3 with image from Randlett et al., 2013
amacrine cell absent, abnormal atoh7th241/th241; ptf1asa126/sa126; cu2Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 3 with image from Randlett et al., 2013
retinal ganglion cell absent, abnormal atoh7th241/th241; ptf1asa126/sa126; cu2Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 3 with image from Randlett et al., 2013
retinal ganglion cell absent, abnormal atoh7th241/th241; ptf1asa126/sa126; nns5Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
retinal inner plexiform layer decreased thickness, abnormal atoh7th241/th241; ptf1asa126/sa126; nns5Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
amacrine cell absent, abnormal atoh7th241/th241; ptf1asa126/sa126; nns5Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
retinal inner plexiform layer position, abnormal atoh7th241/th241; ptf1asa126/sa126; nns5Tg + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
retinal inner plexiform layer YFP expression spatial pattern, abnormal q16bTg ; q16aTg ; q19Tg + MO1-atoh7 + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
retinal inner plexiform layer Cerulean expression spatial pattern, abnormal q16bTg ; q16aTg ; q19Tg + MO1-atoh7 + MO1-ptf1a + MO4-ptf1a + MO4-tp53 standard conditions Fig. 2 with image from Randlett et al., 2013
Citations