Morpholino

MO2-rap1b

ID

ZDB-MRPHLNO-070519-3

Name

MO2-rap1b

Previous Names

rap1b splicing-blocking MO (1)

Target

rap1b (1)

Sequence

5' - CAATAGAAATGATGCAGAACTTGCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-rap1b

Expressed Gene	Anatomy	Figures
bmp4	prechordal plate unspecified	Fig. S3 from Tsai et al., 2007
dlx3b	neural plate	Fig. S3 from Tsai et al., 2007
myod1	adaxial cell somite	Fig. S3 from Tsai et al., 2007
tbxta	notochord	Fig. S3 from Tsai et al., 2007

Phenotype

Phenotype resulting from MO2-rap1b

Phenotype	Fish	Figures
convergent extension delayed, abnormal	WT + MO2-rap1b	Fig. S3 from Tsai et al., 2007
notochord increased width, abnormal	WT + MO2-rap1b	Fig. S3 from Tsai et al., 2007
prechordal plate structure, abnormal	WT + MO2-rap1b	Fig. S3, text only from Tsai et al., 2007
whole organism decreased length, abnormal	WT + MO2-rap1b	Fig. S2, Fig. S3 from Tsai et al., 2007
whole organism increased curvature, abnormal	WT + MO2-rap1b	Fig. S2 from Tsai et al., 2007

Phenotype of all Fish created by or utilizing MO2-rap1b

Phenotype	Fish	Conditions	Figures
whole organism increased curvature, abnormal	WT + MO2-rap1b	standard conditions	Fig. S2 from Tsai et al., 2007
convergent extension delayed, abnormal	WT + MO2-rap1b	standard conditions	Fig. S3 from Tsai et al., 2007
prechordal plate structure, abnormal	WT + MO2-rap1b	standard conditions	Fig. S3, text only from Tsai et al., 2007
whole organism decreased length, abnormal	WT + MO2-rap1b	standard conditions	Fig. S2, Fig. S3 from Tsai et al., 2007
notochord increased width, abnormal	WT + MO2-rap1b	standard conditions	Fig. S3 from Tsai et al., 2007
cardiac muscle gap junction decreased amount, abnormal	TU + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 3 from Dong et al., 2012
pericardium edematous, abnormal	TU + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 1 from Dong et al., 2012
cardiac muscle adherens junction decreased amount, abnormal	TU + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 3 from Dong et al., 2012
caudal fin blistered, abnormal	TU + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 1 from Dong et al., 2012
cardiac conduction disrupted, abnormal	TU + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 4 from Dong et al., 2012
cardiac muscle cardiac myofibril morphology, abnormal	TU + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 3 from Dong et al., 2012
cardiac muscle sarcomere morphology, abnormal	TU + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 3 from Dong et al., 2012
cardiac muscle striated muscle thin filament decreased amount, abnormal	TU + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 3 from Dong et al., 2012
trunk increased curvature, abnormal	TU + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 1 from Dong et al., 2012
heart looping disrupted, abnormal	pku5Et + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 1 from Dong et al., 2012
pericardium edematous, abnormal	pku5Et + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 1 from Dong et al., 2012
heart malformed, abnormal	pku5Et + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 1 from Dong et al., 2012
heart development disrupted, abnormal	pku5Et + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 1 , Fig. 2 from Dong et al., 2012
heart looping disrupted, abnormal	pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. S2 from Dong et al., 2012
heart dilated, abnormal	pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	text only from Dong et al., 2012
heart morphology, abnormal	pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. S2 from Dong et al., 2012
cardiac ventricle decreased size, abnormal	pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	text only from Dong et al., 2012
heart development disrupted, abnormal	pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	Fig. 2 from Dong et al., 2012
pericardium edematous, abnormal	pku5Et; pku6Tg + MO1-rap1aa + MO2-rap1b + MO4-tp53	standard conditions	text only from Dong et al., 2012

Citations