Morpholino
MO2-rap1b
- ID
- ZDB-MRPHLNO-070519-3
- Name
- MO2-rap1b
- Previous Names
-
- rap1b splicing-blocking MO (1)
- Target
- Sequence
-
5' - CAATAGAAATGATGCAGAACTTGCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-rap1b
Expressed Gene | Anatomy | Figures |
---|---|---|
bmp4 |
Fig. S3
from Tsai et al., 2007 |
|
dlx3b |
Fig. S3
from Tsai et al., 2007 |
|
myod1 |
Fig. S3
from Tsai et al., 2007 |
|
tbxta |
Fig. S3
from Tsai et al., 2007 |
1 - 4 of 4
Phenotype
Phenotype resulting from MO2-rap1b
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO2-rap1b
1 - 5 of 24 Show all
Citations
- Lackner, S., Schwendinger-Schreck, J., Jülich, D., and Holley, S.A. (2013) Segmental assembly of fibronectin matrix requires rap1b and integrin alpha5. Developmental Dynamics : an official publication of the American Association of Anatomists. 242(2):122-131
- Dong, W., Yang, Z., Yang, F., Wang, J., Zhuang, Y., Xu, C., Zhang, B., Tian, X.L., and Liu, D. (2012) Suppression of rap1 impairs cardiac myofibrils and conduction system in zebrafish. PLoS One. 7(11):e50960
- Tsai, I.C., Amack, J.D., Gao, Z.H., Band, V., Yost, H.J., and Virshup, D.M. (2007) A Wnt-CKIε-Rap1 Pathway Regulates Gastrulation by Modulating SIPA1L1, a Rap GTPase Activating Protein. Developmental Cell. 12(3):335-347
1 - 3 of 3
Show