Morpholino

MO1-dll4

ID

ZDB-MRPHLNO-070509-1

Name

MO1-dll4

Previous Names

None

Target

dll4 (1)

Sequence

5' - GTTCGAGCTTACCGGCCACCCAAAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice blocking morpholino.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-dll4

No data available

Phenotype

Phenotype resulting from MO1-dll4

Phenotype	Fish	Figures
blood circulation disrupted, abnormal	y1Tg + MO1-dll4	Fig. S1 from Siekmann et al., 2007
blood vessel development disrupted, abnormal	WT + MO1-dll4	Fig. S8 from Sacilotto et al., 2013
blood vessel endothelial cell cell division increased duration, abnormal	ubs1Tg + MO1-dll4	Fig. 2 from Page et al., 2019
dorsal aorta decreased diameter, abnormal	WT + MO1-dll4	Fig. 4 from Bridge et al., 2012
dorsal aorta tm4sf18 expression increased distribution, abnormal	WT + MO1-dll4	Fig. 3 from Page et al., 2019
intersegmental artery structure, abnormal	y1Tg + MO1-dll4	Fig. S1 from Siekmann et al., 2007
intersegmental artery blood vessel endothelial cell increased amount, abnormal	y7Tg + MO1-dll4	Fig. 4, Fig. S7 from Siekmann et al., 2007
intersegmental vein blood vessel endothelial cell increased amount, abnormal	ubs1Tg + MO1-dll4	Fig. 2 from Page et al., 2019
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal	WT + MO1-dll4	Fig. 6 from Bonkhofer et al., 2019
whole organism uxt expression increased amount, abnormal	AB + MO1-dll4	Fig. 5 from Zhou et al., 2015
whole organism tm4sf18 expression increased amount, abnormal	WT + MO1-dll4	Fig. 3 from Page et al., 2019
whole organism kdrl expression increased amount, abnormal	WT + MO1-dll4	Fig. 3 from Page et al., 2019

Phenotype of all Fish created by or utilizing MO1-dll4

Phenotype	Fish	Conditions	Figures
whole organism uxt expression increased amount, abnormal	AB + MO1-dll4	standard conditions	Fig. 5 from Zhou et al., 2015
dorsal aorta decreased diameter, abnormal	WT + MO1-dll4	standard conditions	Fig. 4 from Bridge et al., 2012
blood vessel development disrupted, abnormal	WT + MO1-dll4	standard conditions	Fig. S8 from Sacilotto et al., 2013
whole organism tm4sf18 expression increased amount, abnormal	WT + MO1-dll4	standard conditions	Fig. 3 from Page et al., 2019
dorsal aorta tm4sf18 expression increased distribution, abnormal	WT + MO1-dll4	standard conditions	Fig. 3 from Page et al., 2019
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal	WT + MO1-dll4	standard conditions	Fig. 6 from Bonkhofer et al., 2019
whole organism kdrl expression increased amount, abnormal	WT + MO1-dll4	standard conditions	Fig. 3 from Page et al., 2019
intersegmental vein blood vessel endothelial cell increased amount, abnormal	ubs1Tg + MO1-dll4	standard conditions	Fig. 2 from Page et al., 2019
blood vessel endothelial cell cell division increased duration, abnormal	ubs1Tg + MO1-dll4	standard conditions	Fig. 2 from Page et al., 2019
intersegmental artery structure, abnormal	y1Tg + MO1-dll4	standard conditions	Fig. S1 from Siekmann et al., 2007
blood circulation disrupted, abnormal	y1Tg + MO1-dll4	standard conditions	Fig. S1 from Siekmann et al., 2007
intersegmental artery blood vessel endothelial cell increased amount, abnormal	y7Tg + MO1-dll4	standard conditions	Fig. 4, Fig. S7 from Siekmann et al., 2007
dorsal longitudinal anastomotic vessel morphology, ameliorated	y1Tg + MO1-dll4 + MO1-ptger3	standard conditions	Fig. 3 from Chen et al., 2017
intersegmental vessel sprouting angiogenesis occurrence, ameliorated	y1Tg + MO1-dll4 + MO1-ptger3	standard conditions	Fig. 3 from Chen et al., 2017
intersegmental vessel morphology, ameliorated	y1Tg + MO1-dll4 + MO1-ptger3	standard conditions	Fig. 3 from Chen et al., 2017
intersegmental vessel normal length, ameliorated	s916Tg; y7Tg + MO1-dll4 + MO1-mib1 + MO1-mir-ntu1	standard conditions	Fig. 5 from Shi et al., 2019
intersegmental vessel blood vessel endothelial cell normal amount, ameliorated	s916Tg; y7Tg + MO1-dll4 + MO1-mib1 + MO1-mir-ntu1	standard conditions	Fig. 5 from Shi et al., 2019

Citations