Morpholino

MO4-atoh1a

ID
ZDB-MRPHLNO-070507-4
Name
MO4-atoh1a
Previous Names
  • atoh1a MO3 (1)
Target
Sequence
5' - ATCCATTCTGTTGGTTTGTGCTTTT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-atoh1a
No data available
Phenotype
Phenotype resulting from MO4-atoh1a
Phenotype of all Fish created by or utilizing MO4-atoh1a
Phenotype Fish Conditions Figures
hair cell decreased amount, abnormal AB + MO4-atoh1a standard conditions Fig. 2 with image from Millimaki et al., 2007
neuromast absent, abnormal AB + MO4-atoh1a standard conditions Fig. 2 with image from Millimaki et al., 2007
statoacoustic (VIII) ganglion anatomical region decreased size, abnormal TU + MO4-atoh1a standard conditions Fig. 3Fig. 5 from Wang et al., 2015
posterior lateral line neuromast decreased amount, abnormal WT + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
posterior lateral line primordium GFP expression decreased amount, abnormal sk90Tg + MO4-atoh1a standard conditions Fig. 2 with image from Wang et al., 2018
posterior lateral line neuromast neuromast hair cell absent, abnormal zf106Tg + MO4-atoh1a standard conditions Fig. 3 with image from Lecaudey et al., 2008
posterior lateral line neuromast decreased amount, abnormal zf106Tg + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
neuromast hair cell kinocilium absent, abnormal zf106Tg + MO4-atoh1a standard conditions Fig. 3 with image from Lecaudey et al., 2008
hair cell absent, abnormal AB + MO1-atoh1b + MO4-atoh1a standard conditions Fig. 2 with image from Millimaki et al., 2007
statoacoustic (VIII) ganglion anatomical region decreased size, abnormal TU + MO1-sox9a + MO4-atoh1a standard conditions Fig. 5 from Wang et al., 2015
hair cell absent, abnormal mib1ta52b/ta52b + MO1-atoh1b + MO4-atoh1a standard conditions Fig. 4 with image from Millimaki et al., 2007
posterior lateral line primordium GFP expression decreased amount, abnormal sk89Tg + MO4-atoh1a standard conditions Fig. 2 with image from Wang et al., 2018
neuromast fgf10a expression absent, abnormal fgf3t24149/+; zf106Tg + MO4-atoh1a standard conditions Fig. S1 with image from Wang et al., 2018
neuromast fgf10a expression absent, abnormal fgf3t24149/t24149; zf106Tg + MO4-atoh1a standard conditions Fig. S1 with image from Wang et al., 2018
posterior lateral line neuromast decreased amount, abnormal fgf3t24149/t24149; zf106Tg + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
posterior lateral line neuromast decreased amount, exacerbated anos1ask50/+; anos1ask51/+; anos1bsk52/+; anos1bsk53/+ + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
posterior lateral line neuromast decreased amount, abnormal anos1ask50/+; anos1ask51/+; anos1bsk52/+; anos1bsk53/+ + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
posterior lateral line neuromast decreased amount, abnormal anos1ask50/+; anos1ask51/+; anos1bsk52/+; anos1bsk53/+; zf106Tg + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
posterior lateral line primordium EGFP expression decreased amount, abnormal fgfr1at2227/t2227; sk85Tg; sk89Tg + MO4-atoh1a standard conditions Fig. 4 with image from Wang et al., 2018
posterior lateral line primordium EGFP expression decreased amount, abnormal anos1ask50/+; anos1ask51/+; anos1bsk52/+; anos1bsk53/+; sk85Tg; sk89Tg + MO4-atoh1a standard conditions Fig. 4 with image from Wang et al., 2018
posterior lateral line neuromast decreased amount, abnormal fgf3t24149/t24149; anos1ask50/+; anos1ask51/+; anos1bsk52/+; anos1bsk53/+ + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
posterior lateral line neuromast decreased amount, abnormal fgf3t24149/t24149; anos1ask50/+; anos1ask51/+; anos1bsk52/+; anos1bsk53/+; zf106Tg + MO4-atoh1a standard conditions Fig. 1 with image from Wang et al., 2018
Citations