Morpholino
MO4-notch1a
- ID
- ZDB-MRPHLNO-070328-2
- Name
- MO4-notch1a
- Previous Names
- None
- Target
- Sequence
-
5' - TTCACCAAGAAACGGTTCATAACTC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-notch1a
No data available
Phenotype
Phenotype resulting from MO4-notch1a
No data available
Phenotype of all Fish created by or utilizing MO4-notch1a
1 - 5 of 11 Show all
Citations
- Banote, R.K., Edling, M., Eliassen, F., Kettunen, P., Zetterberg, H., Abramsson, A. (2016) β-Amyloid precursor protein-b is essential for Mauthner cell development in the zebrafish in a Notch-dependent manner. Developmental Biology. 413(1):26-38
- Okigawa, S., Mizoguchi, T., Okano, M., Tanaka, H., Isoda, M., Jiang, Y.J., Suster, M., Higashijima, S.I., Kawakami, K., Itoh, M. (2014) Different combinations of Notch ligands and receptors regulate V2 interneuron progenitor proliferation and V2a/V2b cell fate determination. Developmental Biology. 391(2):196-206
- Quillien, A., Moore, J.C., Shin, M., Siekmann, A.F., Smith, T., Pan, L., Moens, C.B., Parsons, M.J., Lawson, N.D. (2014) Distinct Notch signaling outputs pattern the developing arterial system. Development (Cambridge, England). 141:1544-52
- Bugeon, L., Taylor, H.B., Progatzky, F., Lin, M.I., Ellis, C.D., Welsh, N., Smith, E., Vargesson, N., Gray, C., Renshaw, S.A., Chico, T.J., Zon, L., Lamb, J., and Dallman, M.J. (2011) The NOTCH pathway contributes to cell fate decisions in myelopoiesis. Haematologica. 96(12):1753-60
- Mizoguchi, T., Togawa, S., Kawakami, K., and Itoh, M. (2011) Neuron and sensory epithelial cell fate is sequentially determined by notch signaling in zebrafish lateral line development. The Journal of neuroscience : the official journal of the Society for Neuroscience. 31(43):15522-15530
- Geudens, I., Herpers, R., Hermans, K., Segura, I., Ruiz de Almodovar, C., Bussmann, J., De Smet, F., Vandevelde, W., Hogan, B.M., Siekmann, A., Claes, F., Moore, J.C., Pistocchi, A.S., Loges, S., Mazzone, M., Mariggi, G., Bruyere, F., Cotelli, F., Kerjaschki, D., Noel, A., Foidart, J.M., Gerhardt, H., Ny, A., Langenberg, T., Lawson, N.D., Duckers, H.J., Schulte-Merker, S., Carmeliet, P., and Dewerchin, M. (2010) Role of delta-like-4/Notch in the formation and wiring of the lymphatic network in zebrafish. Arterioscler. Thromb. Vasc. Biol.. 30(9):1695-1702
- Riedel-Kruse, I.H., Müller, C., and Oates, A.C. (2007) Synchrony Dynamics During Initiation, Failure, and Rescue of the Segmentation Clock. Science (New York, N.Y.). 317(5846):1911-1915
- Tsutsumi, M., and Itoh, M. (2007) Novel transcript nort is a downstream target gene of the Notch signaling pathway in zebrafish. Gene expression patterns : GEP. 793):227-232
- Holley, S.A., Jülich, D., Rauch, G.J., Geisler, R., and Nüsslein-Volhard, C. (2002) her1 and the notch pathway function within the oscillator mechanism that regulates zebrafish somitogenesis. Development (Cambridge, England). 129(5):1175-1183
1 - 9 of 9
Show