Community Action Needed: Please respond to the NIH RFI
Morpholino

MO3-notch1a

ID
ZDB-MRPHLNO-070328-1
Name
MO3-notch1a
Previous Names
None
Target
Sequence
5' - GCCTCGGCGTTACAACTTCTTTAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-notch1a
No data available
Phenotype
Phenotype resulting from MO3-notch1a
No data available
Phenotype of all Fish created by or utilizing MO3-notch1a
Phenotype Fish Conditions Figures
hindbrain has extra parts of type Mauthner neuron, abnormal WT + MO3-notch1a + MO4-notch1a control Fig. 7 with image from Banote et al., 2016
VeLD decreased amount, abnormal nns5Tg + MO3-notch1a + MO4-notch1a standard conditions Fig. 5 with image from Okigawa et al., 2014
CiD increased amount, abnormal nns5Tg + MO3-notch1a + MO4-notch1a standard conditions Fig. 5 with image from Okigawa et al., 2014
posterior lateral line ganglion neuron increased amount, abnormal WT + MO2-notch3 + MO3-notch1a + MO3-notch3 + MO4-notch1a standard conditions Fig. 2 from Mizoguchi et al., 2011
hindbrain has number of Mauthner neuron, ameliorated WT + MO3-notch1a + MO4-notch1a + MO5-appb standard conditions Fig. 7 with image from Banote et al., 2016
CiD increased amount, abnormal nns5Tg + MO2-notch1b + MO3-notch1a + MO4-notch1a standard conditions Fig. 5 with image from Okigawa et al., 2014
VeLD decreased amount, abnormal nns5Tg + MO2-notch1b + MO3-notch1a + MO4-notch1a standard conditions Fig. 5 with image from Okigawa et al., 2014
CiD increased amount, abnormal nns5Tg + MO2-notch3 + MO3-notch1a + MO3-notch3 + MO4-notch1a standard conditions Fig. 5 with image from Okigawa et al., 2014
VeLD decreased amount, abnormal nns5Tg + MO2-notch3 + MO3-notch1a + MO3-notch3 + MO4-notch1a standard conditions Fig. 5 with image from Okigawa et al., 2014
CiD increased amount, abnormal nns5Tg + MO2-notch1b + MO2-notch3 + MO3-notch1a + MO3-notch3 + MO4-notch1a standard conditions Fig. 5 with image from Okigawa et al., 2014
VeLD decreased amount, abnormal nns5Tg + MO2-notch1b + MO2-notch3 + MO3-notch1a + MO3-notch3 + MO4-notch1a standard conditions Fig. 5 with image from Okigawa et al., 2014
Citations