Morpholino

MO1-rps19

ID
ZDB-MRPHLNO-070326-7
Name
MO1-rps19
Previous Names
None
Target
Sequence
5' - CACTGTTACACCACCTGGCATCTTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rps19
No data available
Phenotype
Phenotype resulting from MO1-rps19
Phenotype Fish Figures
apoptotic process increased occurrence, abnormal WT + MO1-rps19 Fig. 1 from Torihara et al., 2011
ball increased size, abnormal AB + MO1-rps19 Fig. 3 with image from Uechi et al., 2006
brain segmentation disrupted, abnormal WT + MO1-rps19 Fig. 1 from Uechi et al., 2008
cerebellum decreased thickness, abnormal AB + MO1-rps19 Fig. 3 with image from Uechi et al., 2006
cranium edematous, abnormal AB + MO1-rps19 Fig. 3 from Payne et al., 2012
extension decreased thickness, abnormal AB + MO1-rps19 Fig. 1 from Uechi et al., 2008
Fig. 3 with image from Uechi et al., 2006
eye decreased size, abnormal WT + MO1-rps19 Fig. 1 from Torihara et al., 2011
eye immature, abnormal AB + MO1-rps19 Fig. 3 from Payne et al., 2012
fin aplastic, abnormal AB + MO1-rps19 Fig. 3 with image from Uechi et al., 2006
forebrain morphology, abnormal AB + MO1-rps19 Fig. 3 with image from Uechi et al., 2006
forebrain protruding, abnormal AB + MO1-rps19 Fig. 3 with image from Uechi et al., 2006
fourth ventricle increased size, abnormal AB + MO1-rps19 Fig. 3 with image from Uechi et al., 2006
fourth ventricle opaque, abnormal AB + MO1-rps19 Fig. 3 with image from Uechi et al., 2006
head decreased size, abnormal WT + MO1-rps19 Fig. 1 from Torihara et al., 2011
heart edematous, abnormal AB + MO1-rps19 Fig. 3 from Payne et al., 2012
hemopoiesis process quality, abnormal WT + MO1-rps19 Fig. 4 with image from Zhang et al., 2013
hindbrain opaque, abnormal AB + MO1-rps19 Fig. 3 with image from Uechi et al., 2006
hindbrain undulate, abnormal AB + MO1-rps19 Fig. 3 with image from Uechi et al., 2006
lens absent, abnormal AB + MO1-rps19 Fig. 3 from Payne et al., 2012
midbrain hindbrain boundary aplastic, abnormal AB + MO1-rps19 Fig. 3 with image from Uechi et al., 2006
nucleate erythrocyte apoptotic, abnormal WT + MO1-rps19 Fig. 1 from Torihara et al., 2011
nucleate erythrocyte decreased amount, abnormal WT + MO1-rps19 Fig. 1 with image from Narla et al., 2014
Fig. 1 with image from Jia et al., 2013
Fig. 1Fig. S1 from Payne et al., 2012
Fig. 2 from Torihara et al., 2011
Fig. 2 from Uechi et al., 2008
Fig. 3 with image from Uechi et al., 2006
nucleate erythrocyte hemoglobin complex decreased amount, abnormal AB + MO1-rps19 Fig. 1 with image from Narla et al., 2014
optic tectum aplastic, abnormal AB + MO1-rps19 Fig. 3 with image from Uechi et al., 2006
optic tectum increased size, abnormal AB + MO1-rps19 Fig. 3 with image from Uechi et al., 2006
optic tectum opaque, abnormal AB + MO1-rps19 Fig. 3 with image from Uechi et al., 2006
otic placode aplastic, abnormal AB + MO1-rps19 Fig. 3 with image from Uechi et al., 2006
otic placode decreased size, abnormal AB + MO1-rps19 Fig. 3 with image from Uechi et al., 2006
otic vesicle decreased size, abnormal WT + MO1-rps19 Fig. 1 from Uechi et al., 2008
otolith organ decreased size, abnormal AB + MO1-rps19 Fig. 3 with image from Uechi et al., 2006
pharyngeal arch 3-7 immature, abnormal AB + MO1-rps19 Fig. 1 from Payne et al., 2012
post-vent region bent, abnormal AB + MO1-rps19 Fig. 3 with image from Uechi et al., 2006
post-vent region curved ventral, abnormal WT + MO1-rps19 Fig. 1 with image from Jia et al., 2013
Fig. 1 from Uechi et al., 2008
post-vent region kinked, abnormal AB + MO1-rps19 Fig. 1 from Payne et al., 2012
retina decreased size, abnormal AB + MO1-rps19 Fig. 3 with image from Uechi et al., 2006
tegmentum opaque, abnormal AB + MO1-rps19 Fig. 3 with image from Uechi et al., 2006
whole organism ddx4 expression decreased amount, abnormal AB + MO1-rps19 Fig. 7 from Palasin et al., 2019
whole organism gata1a expression decreased amount, abnormal AB + MO1-rps19 Fig. 6 from Palasin et al., 2019
whole organism nanos1 expression decreased amount, abnormal AB + MO1-rps19 Fig. 7 from Palasin et al., 2019
whole organism decreased length, abnormal AB + MO1-rps19 Fig. 1 from Payne et al., 2012
Fig. 1 from Torihara et al., 2011
whole organism tp53 expression increased amount, abnormal AB + MO1-rps19 Fig. 6 from Palasin et al., 2019
Fig. 2 from Narla et al., 2014
whole organism cdkn1a expression increased amount, abnormal AB + MO1-rps19 Fig. 2 from Narla et al., 2014
whole organism cytosolic small ribosomal subunit decreased amount, abnormal AB + MO1-rps19 Fig. 1 from Uechi et al., 2026
Phenotype of all Fish created by or utilizing MO1-rps19
Phenotype Fish Conditions Figures
fin aplastic, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
whole organism tp53 expression increased amount, abnormal AB + MO1-rps19 standard conditions Fig. 6 from Palasin et al., 2019
Fig. 2 from Narla et al., 2014
tegmentum opaque, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
otolith organ decreased size, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
retina decreased size, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
ball increased size, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
whole organism decreased length, abnormal AB + MO1-rps19 standard conditions Fig. 1 from Payne et al., 2012
whole organism gata1a expression decreased amount, abnormal AB + MO1-rps19 standard conditions Fig. 6 from Palasin et al., 2019
otic placode decreased size, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
extension decreased thickness, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
whole organism tp53 expression increased amount, abnormal AB + MO1-rps19 chemical treatment: L-leucine Fig. 2 from Narla et al., 2014
cranium edematous, abnormal AB + MO1-rps19 standard conditions Fig. 3 from Payne et al., 2012
nucleate erythrocyte hemoglobin complex decreased amount, abnormal AB + MO1-rps19 standard conditions Fig. 1 with image from Narla et al., 2014
midbrain hindbrain boundary aplastic, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
forebrain protruding, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
fourth ventricle opaque, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
eye immature, abnormal AB + MO1-rps19 standard conditions Fig. 3 from Payne et al., 2012
whole organism ddx4 expression decreased amount, abnormal AB + MO1-rps19 standard conditions Fig. 7 from Palasin et al., 2019
whole organism cdkn1a expression increased amount, abnormal AB + MO1-rps19 chemical treatment: L-leucine Fig. 2 from Narla et al., 2014
heart edematous, abnormal AB + MO1-rps19 standard conditions Fig. 3 from Payne et al., 2012
pharyngeal arch 3-7 immature, abnormal AB + MO1-rps19 standard conditions Fig. 1 from Payne et al., 2012
hindbrain undulate, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
whole organism cytosolic small ribosomal subunit decreased amount, abnormal AB + MO1-rps19 standard conditions Fig. 1 from Uechi et al., 2026
fourth ventricle increased size, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
nucleate erythrocyte decreased amount, abnormal AB + MO1-rps19 standard conditions Fig. 1Fig. S1 from Payne et al., 2012
Fig. 3 with image from Uechi et al., 2006
post-vent region kinked, abnormal AB + MO1-rps19 standard conditions Fig. 1 from Payne et al., 2012
whole organism nanos1 expression decreased amount, abnormal AB + MO1-rps19 standard conditions Fig. 7 from Palasin et al., 2019
post-vent region bent, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
optic tectum opaque, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
hindbrain opaque, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
forebrain morphology, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
cerebellum decreased thickness, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
optic tectum aplastic, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
optic tectum increased size, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
whole organism cdkn1a expression increased amount, abnormal AB + MO1-rps19 standard conditions Fig. 2 from Narla et al., 2014
lens absent, abnormal AB + MO1-rps19 standard conditions Fig. 3 from Payne et al., 2012
otic placode aplastic, abnormal AB + MO1-rps19 standard conditions Fig. 3 with image from Uechi et al., 2006
eye decreased size, abnormal WT + MO1-rps19 standard conditions Fig. 1 from Torihara et al., 2011
hemopoiesis process quality, abnormal WT + MO1-rps19 standard conditions Fig. 4 with image from Zhang et al., 2013
head decreased size, abnormal WT + MO1-rps19 standard conditions Fig. 1 from Torihara et al., 2011
brain segmentation disrupted, abnormal WT + MO1-rps19 standard conditions Fig. 1 from Uechi et al., 2008
apoptotic process increased occurrence, abnormal WT + MO1-rps19 standard conditions Fig. 1 from Torihara et al., 2011
otic vesicle decreased size, abnormal WT + MO1-rps19 standard conditions Fig. 1 from Uechi et al., 2008
nucleate erythrocyte apoptotic, abnormal WT + MO1-rps19 standard conditions Fig. 1 from Torihara et al., 2011
nucleate erythrocyte decreased amount, abnormal WT + MO1-rps19 standard conditions Fig. 1 with image from Jia et al., 2013
Fig. 2 from Torihara et al., 2011
Fig. 2 from Uechi et al., 2008
post-vent region curved ventral, abnormal WT + MO1-rps19 standard conditions Fig. 1 with image from Jia et al., 2013
Fig. 1 from Uechi et al., 2008
whole organism decreased length, abnormal WT + MO1-rps19 standard conditions Fig. 1 from Torihara et al., 2011
extension decreased thickness, abnormal WT + MO1-rps19 standard conditions Fig. 1 from Uechi et al., 2008
nucleate erythrocyte decreased amount, abnormal WT + MO1-rps19 + MO4-tp53 standard conditions Fig. 2 from Torihara et al., 2011
nucleate erythrocyte decreased amount, abnormal sd2Tg + MO1-rps19 standard conditions Fig. 1 with image from Narla et al., 2014
nucleate erythrocyte hemoglobin complex decreased amount, abnormal tp53zdf1/zdf1 + MO1-rps19 standard conditions Fig. 1 with image from Narla et al., 2014
Citations