Morpholino

MO1-rps3a

ID
ZDB-MRPHLNO-070326-2
Name
MO1-rps3a
Previous Names
None
Target
Sequence
5' - TTTGCCGACTGCCATGTGAACAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-rps3a
Expressed Gene Anatomy Figures
baxa Fig. 3 from Torihara et al., 2011
bbc3 Fig. 3 from Torihara et al., 2011
cdkn1a Fig. 3 from Torihara et al., 2011
mdm2 Fig. 3 from Torihara et al., 2011
tp53 Fig. 3 from Torihara et al., 2011
Phenotype
Phenotype resulting from MO1-rps3a
Phenotype Fish Figures
ball increased size, abnormal AB + MO1-rps3a Fig. 3 with image from Uechi et al., 2006
ball opaque, abnormal AB + MO1-rps3a Fig. 3 with image from Uechi et al., 2006
cerebellum aplastic, abnormal AB + MO1-rps3a Fig. 3 with image from Uechi et al., 2006
fin aplastic, abnormal AB + MO1-rps3a Fig. 3 with image from Uechi et al., 2006
forebrain protruding, abnormal AB + MO1-rps3a Fig. 3 with image from Uechi et al., 2006
head apoptotic process increased occurrence, abnormal WT + MO1-rps3a Fig. 2 with image from Berres et al., 2017
hindbrain undulate, abnormal AB + MO1-rps3a Fig. 3 with image from Uechi et al., 2006
lens decreased size, abnormal AB + MO1-rps3a Fig. 3 with image from Uechi et al., 2006
midbrain hindbrain boundary aplastic, abnormal AB + MO1-rps3a Fig. 3 with image from Uechi et al., 2006
optic tectum opaque, abnormal AB + MO1-rps3a Fig. 3 with image from Uechi et al., 2006
otic placode decreased size, abnormal AB + MO1-rps3a Fig. 3 with image from Uechi et al., 2006
post-vent region bent, abnormal AB + MO1-rps3a Fig. 3 with image from Uechi et al., 2006
post-vent region curved, abnormal AB + MO1-rps3a Fig. 2 with image,  Fig. 3 with image from Uechi et al., 2006
retina decreased size, abnormal AB + MO1-rps3a Fig. 3 with image from Uechi et al., 2006
telencephalon hypoplastic, abnormal AB + MO1-rps3a Fig. 3 with image from Uechi et al., 2006
trunk increased width, abnormal AB + MO1-rps3a Fig. 2 with image from Uechi et al., 2006
trunk undulate, abnormal AB + MO1-rps3a Fig. 3 with image from Uechi et al., 2006
Phenotype of all Fish created by or utilizing MO1-rps3a
Phenotype Fish Conditions Figures
fin aplastic, abnormal AB + MO1-rps3a standard conditions Fig. 3 with image from Uechi et al., 2006
lens decreased size, abnormal AB + MO1-rps3a standard conditions Fig. 3 with image from Uechi et al., 2006
trunk increased width, abnormal AB + MO1-rps3a standard conditions Fig. 2 with image from Uechi et al., 2006
midbrain hindbrain boundary aplastic, abnormal AB + MO1-rps3a standard conditions Fig. 3 with image from Uechi et al., 2006
hindbrain undulate, abnormal AB + MO1-rps3a standard conditions Fig. 3 with image from Uechi et al., 2006
forebrain protruding, abnormal AB + MO1-rps3a standard conditions Fig. 3 with image from Uechi et al., 2006
ball opaque, abnormal AB + MO1-rps3a standard conditions Fig. 3 with image from Uechi et al., 2006
otic placode decreased size, abnormal AB + MO1-rps3a standard conditions Fig. 3 with image from Uechi et al., 2006
retina decreased size, abnormal AB + MO1-rps3a standard conditions Fig. 3 with image from Uechi et al., 2006
ball increased size, abnormal AB + MO1-rps3a standard conditions Fig. 3 with image from Uechi et al., 2006
optic tectum opaque, abnormal AB + MO1-rps3a standard conditions Fig. 3 with image from Uechi et al., 2006
trunk undulate, abnormal AB + MO1-rps3a standard conditions Fig. 3 with image from Uechi et al., 2006
post-vent region curved, abnormal AB + MO1-rps3a standard conditions Fig. 2 with image,  Fig. 3 with image from Uechi et al., 2006
post-vent region bent, abnormal AB + MO1-rps3a standard conditions Fig. 3 with image from Uechi et al., 2006
telencephalon hypoplastic, abnormal AB + MO1-rps3a standard conditions Fig. 3 with image from Uechi et al., 2006
cerebellum aplastic, abnormal AB + MO1-rps3a standard conditions Fig. 3 with image from Uechi et al., 2006
embryonic cranial skeleton morphogenesis decreased process quality, exacerbated WT + MO1-rps3a chemical treatment by environment: ethanol Fig. 1 with image from Berres et al., 2017
embryonic neurocranium morphogenesis decreased process quality, exacerbated WT + MO1-rps3a chemical treatment by environment: ethanol Fig. 1 with image from Berres et al., 2017
mandibular arch skeleton malformed, exacerbated WT + MO1-rps3a chemical treatment by environment: ethanol Fig. 1 with image from Berres et al., 2017
head apoptotic process increased occurrence, abnormal WT + MO1-rps3a control Fig. 2 with image from Berres et al., 2017
neurocranium malformed, exacerbated WT + MO1-rps3a chemical treatment by environment: ethanol Fig. 1 with image from Berres et al., 2017
head apoptotic process increased occurrence, exacerbated WT + MO1-rps3a chemical treatment by environment: ethanol Fig. 2 with image from Berres et al., 2017
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.