Morpholino

MO1-rps3a

ID

ZDB-MRPHLNO-070326-2

Name

MO1-rps3a

Previous Names

None

Target

rps3a (1)

Sequence

5' - TTTGCCGACTGCCATGTGAACAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rps3a

No data available

Phenotype

Phenotype resulting from MO1-rps3a

Phenotype	Fish	Figures
ball increased size, abnormal	AB + MO1-rps3a	Fig. 3 from Uechi et al., 2006
ball opaque, abnormal	AB + MO1-rps3a	Fig. 3 from Uechi et al., 2006
cerebellum aplastic, abnormal	AB + MO1-rps3a	Fig. 3 from Uechi et al., 2006
fin aplastic, abnormal	AB + MO1-rps3a	Fig. 3 from Uechi et al., 2006
forebrain protruding, abnormal	AB + MO1-rps3a	Fig. 3 from Uechi et al., 2006
head apoptotic process increased occurrence, abnormal	WT + MO1-rps3a	Fig. 2 from Berres et al., 2017
hindbrain undulate, abnormal	AB + MO1-rps3a	Fig. 3 from Uechi et al., 2006
lens decreased size, abnormal	AB + MO1-rps3a	Fig. 3 from Uechi et al., 2006
midbrain hindbrain boundary aplastic, abnormal	AB + MO1-rps3a	Fig. 3 from Uechi et al., 2006
optic tectum opaque, abnormal	AB + MO1-rps3a	Fig. 3 from Uechi et al., 2006
otic placode decreased size, abnormal	AB + MO1-rps3a	Fig. 3 from Uechi et al., 2006
post-vent region bent, abnormal	AB + MO1-rps3a	Fig. 3 from Uechi et al., 2006
post-vent region curved, abnormal	AB + MO1-rps3a	Fig. 2 , Fig. 3 from Uechi et al., 2006
retina decreased size, abnormal	AB + MO1-rps3a	Fig. 3 from Uechi et al., 2006
telencephalon hypoplastic, abnormal	AB + MO1-rps3a	Fig. 3 from Uechi et al., 2006
trunk increased width, abnormal	AB + MO1-rps3a	Fig. 2 from Uechi et al., 2006
trunk undulate, abnormal	AB + MO1-rps3a	Fig. 3 from Uechi et al., 2006

Phenotype of all Fish created by or utilizing MO1-rps3a

Phenotype	Fish	Conditions	Figures
fin aplastic, abnormal	AB + MO1-rps3a	standard conditions	Fig. 3 from Uechi et al., 2006
lens decreased size, abnormal	AB + MO1-rps3a	standard conditions	Fig. 3 from Uechi et al., 2006
trunk increased width, abnormal	AB + MO1-rps3a	standard conditions	Fig. 2 from Uechi et al., 2006
midbrain hindbrain boundary aplastic, abnormal	AB + MO1-rps3a	standard conditions	Fig. 3 from Uechi et al., 2006
hindbrain undulate, abnormal	AB + MO1-rps3a	standard conditions	Fig. 3 from Uechi et al., 2006
forebrain protruding, abnormal	AB + MO1-rps3a	standard conditions	Fig. 3 from Uechi et al., 2006
ball opaque, abnormal	AB + MO1-rps3a	standard conditions	Fig. 3 from Uechi et al., 2006
otic placode decreased size, abnormal	AB + MO1-rps3a	standard conditions	Fig. 3 from Uechi et al., 2006
retina decreased size, abnormal	AB + MO1-rps3a	standard conditions	Fig. 3 from Uechi et al., 2006
ball increased size, abnormal	AB + MO1-rps3a	standard conditions	Fig. 3 from Uechi et al., 2006
optic tectum opaque, abnormal	AB + MO1-rps3a	standard conditions	Fig. 3 from Uechi et al., 2006
trunk undulate, abnormal	AB + MO1-rps3a	standard conditions	Fig. 3 from Uechi et al., 2006
post-vent region curved, abnormal	AB + MO1-rps3a	standard conditions	Fig. 2 , Fig. 3 from Uechi et al., 2006
post-vent region bent, abnormal	AB + MO1-rps3a	standard conditions	Fig. 3 from Uechi et al., 2006
telencephalon hypoplastic, abnormal	AB + MO1-rps3a	standard conditions	Fig. 3 from Uechi et al., 2006
cerebellum aplastic, abnormal	AB + MO1-rps3a	standard conditions	Fig. 3 from Uechi et al., 2006
embryonic cranial skeleton morphogenesis decreased process quality, exacerbated	WT + MO1-rps3a	chemical treatment by environment: ethanol	Fig. 1 from Berres et al., 2017
embryonic neurocranium morphogenesis decreased process quality, exacerbated	WT + MO1-rps3a	chemical treatment by environment: ethanol	Fig. 1 from Berres et al., 2017
mandibular arch skeleton malformed, exacerbated	WT + MO1-rps3a	chemical treatment by environment: ethanol	Fig. 1 from Berres et al., 2017
head apoptotic process increased occurrence, abnormal	WT + MO1-rps3a	control	Fig. 2 from Berres et al., 2017
neurocranium malformed, exacerbated	WT + MO1-rps3a	chemical treatment by environment: ethanol	Fig. 1 from Berres et al., 2017
head apoptotic process increased occurrence, exacerbated	WT + MO1-rps3a	chemical treatment by environment: ethanol	Fig. 2 from Berres et al., 2017

Citations