Morpholino
MO2-baxa
- ID
- ZDB-MRPHLNO-070125-5
- Name
- MO2-baxa
- Previous Names
-
- MO2-bax
- zBax1MO (1)
- Target
- Sequence
-
5' - TGAAAATAAGCGAACTGAAGAAGAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-baxa
No data available
Phenotype
Phenotype resulting from MO2-baxa
No data available
Phenotype of all Fish created by or utilizing MO2-baxa
from 1 - 2 of 2
Citations
- Nishiwaki, Y., Yoshizawa, A., Kojima, Y., Oguri, E., Nakamura, S., Suzuki, S., Yuasa-Kawada, J., Kinoshita-Kawada, M., Mochizuki, T., and Masai, I. (2013) The BH3-Only SNARE BNip1 Mediates Photoreceptor Apoptosis in Response to Vesicular Fusion Defects. Developmental Cell. 25(4):374-387
- Pant, S.D., March, L.D., Famulski, J.K., French, C.R., Lehmann, O.J., and Waskiewicz, A.J. (2013) Molecular mechanisms regulating ocular apoptosis in zebrafish gdf6a mutants. Investigative ophthalmology & visual science. 54(8):5871-5879
- Gerety, S.S., and Wilkinson, D.G. (2011) Morpholino artifacts provide pitfalls and reveal a novel role for pro-apoptotic genes in hindbrain boundary development. Developmental Biology. 350(2):279-289
- Kratz, E., Eimon, P.M., Mukhyala, K., Stern, H., Zha, J., Strasser, A., Hart, R., and Ashkenazi A. (2006) Functional characterization of the Bcl-2 gene family in the zebrafish. Cell death and differentiation. 13(10):1631-1640
1 - 4 of 4
Show