Morpholino

MO2-wnt8b

ID
ZDB-MRPHLNO-070116-1
Name
MO2-wnt8b
Previous Names
None
Target
Sequence
5' - AGGGAGACTTTTCTTCACCTTTCAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wnt8b
No data available
Phenotype
Phenotype resulting from MO2-wnt8b
Phenotype Fish Figures
anterior commissure has fewer parts of type anterior commissure axon, abnormal WT + MO2-wnt8b Fig. 2 from Hofmeister et al., 2013
anterior commissure commissural neuron axon guidance decreased process quality, abnormal WT + MO2-wnt8b Fig. 2Fig. 3 from Hofmeister et al., 2013
anterior commissure medial region has fewer parts of type glial cell (sensu Vertebrata), abnormal WT + MO2-wnt8b Fig. 2 from Hofmeister et al., 2013
brain morphology, abnormal TU + MO2-wnt8b Figure 2 with image from Ha et al., 2023
diencephalon dopaminergic neuron increased amount, abnormal WT + MO2-wnt8b Fig. 8 with imageFig. 9 with image from Russek-Blum et al., 2008
eye decreased pigmentation, abnormal TU + MO2-wnt8b Figure 2 with image from Ha et al., 2023
forebrain lacks all parts of type anterior commissure, abnormal WT + MO2-wnt8b Fig. 3 from Hofmeister et al., 2013
forebrain Roundabout signaling pathway involved in axon guidance increased process quality, abnormal WT + MO2-wnt8b Fig. 3 from Hofmeister et al., 2013
forebrain neuron differentiation disrupted, abnormal WT + MO2-wnt8b Fig. 7 with image from Lee et al., 2006
hypothalamus posterior side morphology, abnormal WT + MO2-wnt8b Fig. 1 with imageFig. 7 with image from Lee et al., 2006
hypothalamus development disrupted, abnormal WT + MO2-wnt8b Fig. 7 with image from Lee et al., 2006
pericardium edematous, abnormal TU + MO2-wnt8b Figure 2 with image from Ha et al., 2023
post-vent region curved, abnormal TU + MO2-wnt8b Figure 2 with image from Ha et al., 2023
post-vent region deformed, abnormal TU + MO2-wnt8b Figure 2 with image from Ha et al., 2023
postoptic commissure decreased size, abnormal WT + MO2-wnt8b Fig. 3 from Hofmeister et al., 2013
postoptic commissure has fewer parts of type postoptic commissure axon, abnormal WT + MO2-wnt8b Fig. 2 from Hofmeister et al., 2013
postoptic commissure commissural neuron axon guidance decreased process quality, abnormal WT + MO2-wnt8b Fig. 2Fig. 3 from Hofmeister et al., 2013
postoptic commissure medial region has fewer parts of type glial cell (sensu Vertebrata), abnormal WT + MO2-wnt8b Fig. 2 from Hofmeister et al., 2013
Phenotype of all Fish created by or utilizing MO2-wnt8b
Phenotype Fish Conditions Figures
post-vent region deformed, abnormal TU + MO2-wnt8b control Figure 2 with image from Ha et al., 2023
brain morphology, abnormal TU + MO2-wnt8b control Figure 2 with image from Ha et al., 2023
post-vent region curved, abnormal TU + MO2-wnt8b control Figure 2 with image from Ha et al., 2023
eye decreased pigmentation, abnormal TU + MO2-wnt8b control Figure 2 with image from Ha et al., 2023
pericardium edematous, abnormal TU + MO2-wnt8b control Figure 2 with image from Ha et al., 2023
postoptic commissure decreased size, abnormal WT + MO2-wnt8b standard conditions Fig. 3 from Hofmeister et al., 2013
forebrain lacks all parts of type anterior commissure, abnormal WT + MO2-wnt8b standard conditions Fig. 3 from Hofmeister et al., 2013
anterior commissure has fewer parts of type anterior commissure axon, abnormal WT + MO2-wnt8b standard conditions Fig. 2 from Hofmeister et al., 2013
anterior commissure commissural neuron axon guidance decreased process quality, abnormal WT + MO2-wnt8b standard conditions Fig. 2Fig. 3 from Hofmeister et al., 2013
anterior commissure medial region has fewer parts of type glial cell (sensu Vertebrata), abnormal WT + MO2-wnt8b standard conditions Fig. 2 from Hofmeister et al., 2013
diencephalon dopaminergic neuron increased amount, abnormal WT + MO2-wnt8b standard conditions Fig. 8 with imageFig. 9 with image from Russek-Blum et al., 2008
hypothalamus development disrupted, abnormal WT + MO2-wnt8b standard conditions Fig. 7 with image from Lee et al., 2006
postoptic commissure commissural neuron axon guidance decreased process quality, abnormal WT + MO2-wnt8b standard conditions Fig. 2Fig. 3 from Hofmeister et al., 2013
forebrain Roundabout signaling pathway involved in axon guidance increased process quality, abnormal WT + MO2-wnt8b standard conditions Fig. 3 from Hofmeister et al., 2013
hypothalamus posterior side morphology, abnormal WT + MO2-wnt8b standard conditions Fig. 1 with imageFig. 7 with image from Lee et al., 2006
postoptic commissure medial region has fewer parts of type glial cell (sensu Vertebrata), abnormal WT + MO2-wnt8b standard conditions Fig. 2 from Hofmeister et al., 2013
postoptic commissure has fewer parts of type postoptic commissure axon, abnormal WT + MO2-wnt8b standard conditions Fig. 2 from Hofmeister et al., 2013
forebrain neuron differentiation disrupted, abnormal WT + MO2-wnt8b standard conditions Fig. 7 with image from Lee et al., 2006
diencephalon dopaminergic neuron decreased amount, abnormal fezf2m808/m808 + MO2-wnt8b standard conditions Fig. 9 with image from Russek-Blum et al., 2008
embryonic pattern specification disrupted, abnormal AB + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
hindbrain disorganized, abnormal AB + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
postoptic commissure medial region has fewer parts of type glial cell (sensu Vertebrata), abnormal WT + MO2-wnt8b + MO3-fzd3a standard conditions Fig. 6 from Hofmeister et al., 2013
postoptic commissure has fewer parts of type postoptic commissure axon, abnormal WT + MO2-wnt8b + MO3-fzd3a standard conditions Fig. 6 from Hofmeister et al., 2013
anterior commissure medial region lacks all parts of type glial cell (sensu Vertebrata), abnormal WT + MO2-wnt8b + MO3-fzd3a standard conditions Fig. 6 from Hofmeister et al., 2013
anterior commissure commissural neuron axon guidance decreased process quality, abnormal WT + MO2-wnt8b + MO3-fzd3a standard conditions Fig. 5Fig. 6 from Hofmeister et al., 2013
forebrain Roundabout signaling pathway involved in axon guidance increased process quality, abnormal WT + MO2-wnt8b + MO3-fzd3a standard conditions Fig. 5 from Hofmeister et al., 2013
postoptic commissure commissural neuron axon guidance decreased process quality, abnormal WT + MO2-wnt8b + MO3-fzd3a standard conditions Fig. 5Fig. 6 from Hofmeister et al., 2013
postoptic commissure decreased size, abnormal WT + MO2-wnt8b + MO3-fzd3a standard conditions Fig. 5 from Hofmeister et al., 2013
postoptic commissure axon defasciculated, abnormal WT + MO2-wnt8b + MO3-fzd3a standard conditions Fig. 5 from Hofmeister et al., 2013
forebrain lacks all parts of type anterior commissure, abnormal WT + MO2-wnt8b + MO3-fzd3a standard conditions Fig. 5 from Hofmeister et al., 2013
anterior commissure lacks all parts of type anterior commissure axon, abnormal WT + MO2-wnt8b + MO3-fzd3a standard conditions Fig. 6 from Hofmeister et al., 2013
radial glial cell cell projection irregular spatial pattern, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
embryonic pattern specification disrupted, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
rhombomere primary neuron crowded, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
radial glial cell cell projection tangled, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
axon guidance disrupted, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
hindbrain disorganized, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
rhombomere primary neuron disorganized, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
hindbrain commissure neuron absent, abnormal Df(Chr23:acvr1ba,sp5l,wnt1,wnt10b)w5/w5 + MO2-wnt3a + MO2-wnt8b standard conditions Fig. 2 with image from Riley et al., 2004
Citations