Morpholino
MO2-sox2
- ID
- ZDB-MRPHLNO-060922-4
- Name
- MO2-sox2
- Previous Names
-
- sox2-MO1 (1)
- Target
- Sequence
-
5' - AACCGATTTTCTCGAAAGTCTACCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sox2
Expressed Gene | Anatomy | Figures |
---|---|---|
atoh1a |
Fig. 1 ![]() |
|
sox2 |
Fig. 1 ![]() Fig. 1 from Kamachi et al., 2008 |
1 - 2 of 2
Phenotype
Phenotype resulting from MO2-sox2
1 - 3 of 3
Phenotype of all Fish created by or utilizing MO2-sox2
1 - 3 of 3
Citations
- Millimaki, B.B., Sweet, E.M., and Riley, B.B. (2010) Sox2 is required for maintenance and regeneration, but not initial development, of hair cells in the zebrafish inner ear. Developmental Biology. 338(2):262-269
- Kamachi, Y., Okuda, Y., and Kondoh, H. (2008) Quantitative assessment of the knockdown efficiency of morpholino antisense oligonucleotides in zebrafish embryos using a luciferase assay. Genesis (New York, N.Y. : 2000). 46(1):1-7
- Pujic, Z., Omori, Y., Tsujikawa, M., Thisse, B., Thisse, C., and Malicki, J. (2006) Reverse genetic analysis of neurogenesis in the zebrafish retina. Developmental Biology. 293(2):330-347
1 - 3 of 3
Show