Morpholino

MO1-sim1a

ID
ZDB-MRPHLNO-060921-2
Name
MO1-sim1a
Previous Names
None
Target
Sequence
5' - TCGACTTCTCCTTCATGCTCTACGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
targeted to translation-start
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-sim1a
No data available
Phenotype
Phenotype resulting from MO1-sim1a
Phenotype Fish Figures
corpuscles of Stannius stc1 expression absent, abnormal TU + MO1-sim1a Fig. 3 with image from Cheng et al., 2015
embryo development delayed, abnormal WT + MO1-sim1a Fig. 6 with imageFig. 7 with image from Eaton et al., 2006
eye decreased size, abnormal WT + MO1-sim1a Fig. 2 with image from Cheng et al., 2015
Fig. 5 with image from Eaton et al., 2008
Fig. 6 with imageFig. 7 with image from Eaton et al., 2006
head apoptotic, abnormal TU + MO1-sim1a Fig. 2 with image from Cheng et al., 2015
head decreased size, abnormal TU + MO1-sim1a Fig. 2 with image from Cheng et al., 2015
Fig. 5 with image from Eaton et al., 2008
Fig. 6 with imageFig. 7 with image from Eaton et al., 2006
heart edematous, abnormal TU + MO1-sim1a Fig. 2 with image from Cheng et al., 2015
neuroendocrine cell decreased amount, abnormal WT + MO1-sim1a Fig. 5 with image from Eaton et al., 2006
preoptic area pou3f2b expression decreased amount, abnormal WT + MO1-sim1a Fig. 3 from Kasher et al., 2016
preoptic area pou3f2a expression decreased amount, abnormal WT + MO1-sim1a Fig. 3 from Kasher et al., 2016
preoptic area morphology, abnormal WT + MO1-sim1a Fig. 5 with image from Eaton et al., 2008
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-sim1a Fig. 7 S2 with image from Poureetezadi et al., 2016
pronephric nephron tubule development process quality, abnormal TU + MO1-sim1a Fig. 6 with imageFig. 7 with image from Cheng et al., 2015
pronephric proximal convoluted tubule distended, abnormal TU + MO1-sim1a + MO1-tp53 Fig. 3 with imageFig. 6 with imageFig. S6 with image from Cheng et al., 2015
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal TU + MO1-sim1a Fig. 7 S2 with image from Poureetezadi et al., 2016
Fig. 3 with image from Cheng et al., 2015
pronephric proximal convoluted tubule slc20a1a expression mislocalised, abnormal TU + MO1-sim1a Fig. 3 with image from Cheng et al., 2015
pronephric proximal convoluted tubule mislocalised posteriorly, abnormal TU + MO1-sim1a Fig. 3 with image from Cheng et al., 2015
pronephric proximal convoluted tubule straight, abnormal TU + MO1-sim1a Fig. 2 with image from Cheng et al., 2015
pronephric proximal straight tubule absent, abnormal TU + MO1-sim1a Fig. 7 with image from Poureetezadi et al., 2016
pronephric proximal straight tubule trpm7 expression absent, abnormal TU + MO1-sim1a Fig. 7 with image from Poureetezadi et al., 2016
Fig. 3 with image from Cheng et al., 2015
pronephric proximal straight tubule decreased size, abnormal TU + MO1-sim1a Fig. 3 with imageFig. S6 with image from Cheng et al., 2015
pronephric proximal tubule development decreased process quality, abnormal TU + MO1-sim1a + MO1-tp53 Fig. S6 with image from Cheng et al., 2015
pronephric proximal tubule morphogenesis decreased process quality, abnormal TU + MO1-sim1a Fig. 2 with imageFig. 3 with image from Cheng et al., 2015
pronephric proximal tubule morphogenesis process quality, abnormal TU + MO1-sim1a Fig. 3 with image from Cheng et al., 2015
pronephros lacks all parts of type pronephric proximal straight tubule, abnormal TU + MO1-sim1a + MO1-tp53 Fig. 6 with imageFig. S6 with image from Cheng et al., 2015
pronephros lacks all parts of type corpuscles of Stannius, abnormal TU + MO1-sim1a Fig. 3 with imageFig. 6 with imageFig. 7 with imageFig. S6 with image from Cheng et al., 2015
renal filtration decreased process quality, abnormal TU + MO1-sim1a Fig. 2 with image from Cheng et al., 2015
Phenotype of all Fish created by or utilizing MO1-sim1a
Phenotype Fish Conditions Figures
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal TU + MO1-sim1a standard conditions Fig. 7 S2 with image from Poureetezadi et al., 2016
Fig. 3 with image from Cheng et al., 2015
heart edematous, abnormal TU + MO1-sim1a standard conditions Fig. 2 with image from Cheng et al., 2015
pronephric distal early tubule mislocalised posteriorly, abnormal TU + MO1-sim1a chemical treatment: all-trans-retinoic acid Fig. 6 with image from Cheng et al., 2015
pronephric proximal convoluted tubule slc20a1a expression mislocalised, abnormal TU + MO1-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric distal late tubule increased length, abnormal TU + MO1-sim1a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 7 with image from Cheng et al., 2015
pronephric proximal straight tubule decreased size, abnormal TU + MO1-sim1a standard conditions Fig. 3 with imageFig. S6 with image from Cheng et al., 2015
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-sim1a control Fig. 7 S2 with image from Poureetezadi et al., 2016
pronephric distal late tubule decreased length, abnormal TU + MO1-sim1a chemical treatment: all-trans-retinoic acid Fig. 6 with image from Cheng et al., 2015
pronephric distal early tubule slc12a1 expression spatial pattern, ameliorated TU + MO1-sim1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 7 S2 with image from Poureetezadi et al., 2016
pronephric distal early tubule mislocalised anteriorly, abnormal TU + MO1-sim1a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 7 with image from Cheng et al., 2015
pronephric proximal straight tubule trpm7 expression absent, abnormal TU + MO1-sim1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 7 with image from Poureetezadi et al., 2016
pronephric proximal convoluted tubule mislocalised posteriorly, abnormal TU + MO1-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric proximal tubule morphogenesis process quality, abnormal TU + MO1-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephros lacks all parts of type pronephric proximal straight tubule, abnormal TU + MO1-sim1a standard conditions Fig. 6 with image from Cheng et al., 2015
pronephric proximal convoluted tubule distended, abnormal TU + MO1-sim1a standard conditions Fig. 3 with imageFig. 6 with imageFig. S6 with image from Cheng et al., 2015
pronephric nephron tubule development process quality, abnormal TU + MO1-sim1a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 7 with image from Cheng et al., 2015
renal filtration decreased process quality, abnormal TU + MO1-sim1a standard conditions Fig. 2 with image from Cheng et al., 2015
pronephric proximal convoluted tubule distended, abnormal TU + MO1-sim1a chemical treatment: all-trans-retinoic acid Fig. 6 with image from Cheng et al., 2015
pronephros lacks all parts of type corpuscles of Stannius, abnormal TU + MO1-sim1a chemical treatment: all-trans-retinoic acid Fig. 6 with image from Cheng et al., 2015
pronephric proximal straight tubule absent, abnormal TU + MO1-sim1a standard conditions Fig. 7 with image from Poureetezadi et al., 2016
pronephros lacks all parts of type corpuscles of Stannius, abnormal TU + MO1-sim1a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 7 with image from Cheng et al., 2015
pronephros lacks all parts of type corpuscles of Stannius, abnormal TU + MO1-sim1a standard conditions Fig. 3 with imageFig. 6 with imageFig. 7 with imageFig. S6 with image from Cheng et al., 2015
head apoptotic, abnormal TU + MO1-sim1a standard conditions Fig. 2 with image from Cheng et al., 2015
eye decreased size, abnormal TU + MO1-sim1a standard conditions Fig. 2 with image from Cheng et al., 2015
pronephric proximal straight tubule absent, abnormal TU + MO1-sim1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 7 with image from Poureetezadi et al., 2016
pronephric proximal convoluted tubule straight, abnormal TU + MO1-sim1a standard conditions Fig. 2 with image from Cheng et al., 2015
pronephric nephron tubule development process quality, abnormal TU + MO1-sim1a standard conditions Fig. 6 with imageFig. 7 with image from Cheng et al., 2015
head decreased size, abnormal TU + MO1-sim1a standard conditions Fig. 2 with image from Cheng et al., 2015
pronephric nephron tubule development process quality, abnormal TU + MO1-sim1a chemical treatment: all-trans-retinoic acid Fig. 6 with image from Cheng et al., 2015
pronephros lacks all parts of type pronephric proximal straight tubule, abnormal TU + MO1-sim1a chemical treatment: all-trans-retinoic acid Fig. 6 with image from Cheng et al., 2015
pronephric proximal tubule morphogenesis decreased process quality, abnormal TU + MO1-sim1a standard conditions Fig. 2 with imageFig. 3 with image from Cheng et al., 2015
corpuscles of Stannius stc1 expression absent, abnormal TU + MO1-sim1a standard conditions Fig. 3 with image from Cheng et al., 2015
pronephric proximal straight tubule trpm7 expression absent, abnormal TU + MO1-sim1a standard conditions Fig. 7 with image from Poureetezadi et al., 2016
Fig. 3 with image from Cheng et al., 2015
pronephric distal early tubule increased length, abnormal TU + MO1-sim1a chemical treatment: 4-(diethylamino)benzaldehyde Fig. 7 with image from Cheng et al., 2015
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-sim1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 7 S2 with image from Poureetezadi et al., 2016
pronephric proximal convoluted tubule slc20a1a expression increased distribution, abnormal TU + MO1-sim1a chemical treatment by environment: 16,16-dimethylprostaglandin E2 Fig. 7 S2 with image from Poureetezadi et al., 2016
pronephros lacks all parts of type corpuscles of Stannius, abnormal TU + MO1-sim1a + MO1-tp53 standard conditions Fig. S6 with image from Cheng et al., 2015
pronephric proximal convoluted tubule distended, abnormal TU + MO1-sim1a + MO1-tp53 standard conditions Fig. S6 with image from Cheng et al., 2015
pronephric proximal tubule development decreased process quality, abnormal TU + MO1-sim1a + MO1-tp53 standard conditions Fig. S6 with image from Cheng et al., 2015
pronephros lacks all parts of type pronephric proximal straight tubule, abnormal TU + MO1-sim1a + MO1-tp53 standard conditions Fig. S6 with image from Cheng et al., 2015
embryo development delayed, abnormal WT + MO1-sim1a standard conditions Fig. 6 with imageFig. 7 with image from Eaton et al., 2006
preoptic area pou3f2a expression decreased amount, abnormal WT + MO1-sim1a standard conditions Fig. 3 from Kasher et al., 2016
eye decreased size, abnormal WT + MO1-sim1a standard conditions Fig. 5 with image from Eaton et al., 2008
Fig. 6 with imageFig. 7 with image from Eaton et al., 2006
head decreased size, abnormal WT + MO1-sim1a standard conditions Fig. 5 with image from Eaton et al., 2008
Fig. 6 with imageFig. 7 with image from Eaton et al., 2006
neuroendocrine cell decreased amount, abnormal WT + MO1-sim1a standard conditions Fig. 5 with image from Eaton et al., 2006
preoptic area pou3f2b expression decreased amount, abnormal WT + MO1-sim1a standard conditions Fig. 3 from Kasher et al., 2016
preoptic area morphology, abnormal WT + MO1-sim1a standard conditions Fig. 5 with image from Eaton et al., 2008
Citations