Morpholino
MO4-isl1a
- ID
- ZDB-MRPHLNO-060728-3
- Name
- MO4-isl1a
- Previous Names
-
- MO4-isl1
- Target
- Sequence
-
5' - CCCATGTCAAGAAAGTAAGGCGGTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-isl1a
No data available
Phenotype
Phenotype resulting from MO4-isl1a
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO4-isl1a
1 - 5 of 11 Show all
Citations
- Guerra, A., Germano, R.F., Stone, O., Arnaout, R., Guenther, S., Ahuja, S., Uribe, V., Vanhollebeke, B., Stainier, D.Y., Reischauer, S. (2018) Distinct myocardial lineages break atrial symmetry during cardiogenesis in zebrafish. eLIFE. 7
- Nasif, S., de Souza, F.S., González, L.E., Yamashita, M., Orquera, D.P., Low, M.J., Rubinstein, M. (2015) Islet 1 specifies the identity of hypothalamic melanocortin neurons and is critical for normal food intake and adiposity in adulthood. Proceedings of the National Academy of Sciences of the United States of America. 112(15):E1861-70
- Witzel, H.R., Jungblut, B., Choe, C.P., Crump, J.G., Braun, T., and Dobreva, G. (2012) The LIM Protein Ajuba Restricts the Second Heart Field Progenitor Pool by Regulating Isl1 Activity. Developmental Cell. 23(1):58-70
- Tanaka, H., Nojima, Y., Shoji, W., Sato, M., Nakayama, R., Ohshima, T., and Okamoto, H. (2011) Islet1 selectively promotes peripheral axon outgrowth in Rohon-Beard primary sensory neurons. Developmental Dynamics : an official publication of the American Association of Anatomists. 240(1):9-22
- Hutchinson, S.A., and Eisen, J.S. (2006) Islet1 and Islet2 have equivalent abilities to promote motoneuron formation and to specify motoneuron subtype identity. Development (Cambridge, England). 133(11):2137-2147
1 - 5 of 5
Show