Morpholino

MO4-isl1a

ID

ZDB-MRPHLNO-060728-3

Name

MO4-isl1a

Previous Names

Target

Sequence

5' - CCCATGTCAAGAAAGTAAGGCGGTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-isl1a

No data available

Phenotype

Phenotype resulting from MO4-isl1a

Phenotype	Fish	Figures
heart edematous, abnormal	AB + MO4-isl1a	Fig. 7 from Nasif et al., 2015
heart isl1a expression increased distribution, abnormal	s883Tg + MO4-isl1a	Fig. 4 from Witzel et al., 2012
heart development disrupted, abnormal	AB + MO4-isl1a	Fig. 7 from Nasif et al., 2015
hypothalamus neuron decreased amount, abnormal	AB + MO4-isl1a	Fig. 7 from Nasif et al., 2015
peripheral nervous system neuron axonogenesis decreased occurrence, abnormal	WT + MO4-isl1a	Fig. 4 from Tanaka et al., 2011
post-vent region curved ventral, abnormal	AB + MO4-isl1a	Fig. 7 from Nasif et al., 2015
Rohon-Beard neuron axon decreased amount, abnormal	WT + MO4-isl1a	Fig. 4 from Tanaka et al., 2011
whole organism decreased size, abnormal	AB + MO4-isl1a	Fig. 7 from Nasif et al., 2015

Phenotype of all Fish created by or utilizing MO4-isl1a

Phenotype	Fish	Conditions	Figures
heart development disrupted, abnormal	AB + MO4-isl1a	standard conditions	Fig. 7 from Nasif et al., 2015
post-vent region curved ventral, abnormal	AB + MO4-isl1a	standard conditions	Fig. 7 from Nasif et al., 2015
hypothalamus neuron decreased amount, abnormal	AB + MO4-isl1a	standard conditions	Fig. 7 from Nasif et al., 2015
whole organism decreased size, abnormal	AB + MO4-isl1a	standard conditions	Fig. 7 from Nasif et al., 2015
heart edematous, abnormal	AB + MO4-isl1a	standard conditions	Fig. 7 from Nasif et al., 2015
peripheral nervous system neuron axonogenesis decreased occurrence, abnormal	WT + MO4-isl1a	standard conditions	Fig. 4 from Tanaka et al., 2011
Rohon-Beard neuron axon decreased amount, abnormal	WT + MO4-isl1a	standard conditions	Fig. 4 from Tanaka et al., 2011
heart isl1a expression increased distribution, abnormal	s883Tg + MO4-isl1a	standard conditions	Fig. 4 from Witzel et al., 2012
heart isl1a expression increased distribution, abnormal	s883Tg + MO1-ajuba + MO4-isl1a	standard conditions	Fig. 4 from Witzel et al., 2012
cardiac muscle cell increased amount, abnormal	s883Tg + MO1-ajuba + MO4-isl1a	standard conditions	Fig. 4 from Witzel et al., 2012
cardiac muscle cell mislocalised, abnormal	s883Tg + MO1-ajuba + MO4-isl1a	standard conditions	Fig. 4 from Witzel et al., 2012

Citations