Morpholino

MO1-dvl3a

ID
ZDB-MRPHLNO-060724-2
Name
MO1-dvl3a
Previous Names
  • dsh 3 MO (1)
  • MO1-dvl3
Target
Sequence
5' - GGTAGATAACTTTAGTCTCCCCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genome Build: GRCz11Chromosome: 2
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dvl3a
Expressed Gene Anatomy Figures
myod1 Fig. 6 from Angers et al., 2006
Phenotype
Phenotype resulting from MO1-dvl3a
No data available
Phenotype of all Fish created by or utilizing MO1-dvl3a
Phenotype Fish Conditions Figures
post-anal tail morphogenesis having extra processual parts post-anal tail morphogenesis, abnormal WT + MO1-dvl2 + MO1-dvl3a standard conditions Fig. 3 with image from Yang et al., 2011
somite increased width, abnormal WT + MO1-dvl2 + MO1-dvl3a standard conditions Fig. 6 from Angers et al., 2006
whole organism decreased length, abnormal WT + MO1-dvl2 + MO1-dvl3a standard conditions Fig. 6 from Angers et al., 2006
post-vent region deformed, abnormal WT + MO1-dvl2 + MO1-dvl3a standard conditions Fig. 3 with image from Yang et al., 2011
post-anal tail morphogenesis disrupted, abnormal WT + MO1-dvl2 + MO1-dvl3a standard conditions Fig. 3 with image from Yang et al., 2011
whole organism has extra parts of type post-vent region, abnormal WT + MO1-dvl2 + MO1-dvl3a standard conditions Fig. 3 with image from Yang et al., 2011
convergent extension disrupted, abnormal WT + MO1-dvl2 + MO1-dvl3a standard conditions Fig. 6 from Angers et al., 2006
post-vent region deformed, abnormal WT + MO1-dvl3a + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
whole organism has extra parts of type post-vent region, abnormal WT + MO1-dvl3a + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
post-anal tail morphogenesis disrupted, abnormal WT + MO1-dvl3a + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
post-anal tail morphogenesis having extra processual parts post-anal tail morphogenesis, abnormal WT + MO1-dvl3a + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
convergent extension involved in gastrulation process quality, abnormal WT + MO1-dvl3a + MO3-dvl2 standard conditions Fig. s8 with image from Cheng et al., 2017
post-anal tail morphogenesis disrupted, abnormal tll1tc263a/tc263a + MO1-dvl2 + MO1-dvl3a standard conditions Fig. 3 with image from Yang et al., 2011
whole organism has extra parts of type post-vent region, abnormal tll1tc263a/tc263a + MO1-dvl2 + MO1-dvl3a standard conditions Fig. 3 with image from Yang et al., 2011
post-anal tail morphogenesis having extra processual parts post-anal tail morphogenesis, abnormal tll1tc263a/tc263a + MO1-dvl2 + MO1-dvl3a standard conditions Fig. 3 with image from Yang et al., 2011
post-vent region deformed, abnormal tll1tc263a/tc263a + MO1-dvl2 + MO1-dvl3a standard conditions Fig. 3 with image from Yang et al., 2011
post-anal tail morphogenesis disrupted, abnormal WT + MO1-cdh2 + MO1-dvl2 + MO1-dvl3a standard conditions Fig. 5 with image from Yang et al., 2011
post-anal tail morphogenesis having extra processual parts post-anal tail morphogenesis, abnormal WT + MO1-cdh2 + MO1-dvl2 + MO1-dvl3a standard conditions Fig. 5 with image from Yang et al., 2011
post-vent region deformed, abnormal WT + MO1-cdh2 + MO1-dvl2 + MO1-dvl3a standard conditions Fig. 5 with image from Yang et al., 2011
whole organism has extra parts of type post-vent region, abnormal WT + MO1-cdh2 + MO1-dvl2 + MO1-dvl3a standard conditions Fig. 5 with image from Yang et al., 2011
establishment of spindle orientation process quality, abnormal WT + MO1-dvl1b + MO1-dvl2 + MO1-dvl3a standard conditions Fig. 6 with image from Segalen et al., 2010
post-anal tail morphogenesis disrupted, abnormal WT + MO1-dvl2 + MO1-dvl3a + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
post-vent region deformed, abnormal WT + MO1-dvl2 + MO1-dvl3a + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
post-anal tail morphogenesis having extra processual parts post-anal tail morphogenesis, abnormal WT + MO1-dvl2 + MO1-dvl3a + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
whole organism has extra parts of type post-vent region, abnormal WT + MO1-dvl2 + MO1-dvl3a + MO2-tll1 standard conditions Fig. 3 with image from Yang et al., 2011
Citations
TSV
1 - 6 of 6
Show
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.