Morpholino

MO1-dvl3a

ID

ZDB-MRPHLNO-060724-2

Name

MO1-dvl3a

Previous Names

dsh 3 MO (1)
MO1-dvl3

Target

dvl3a (1)

Sequence

5' - GGTAGATAACTTTAGTCTCCCCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-dvl3a

Expressed Gene	Anatomy	Figures
myod1	somite	Fig. 6 from Angers et al., 2006

Phenotype

Phenotype resulting from MO1-dvl3a

No data available

Phenotype of all Fish created by or utilizing MO1-dvl3a

Phenotype	Fish	Conditions	Figures
post-anal tail morphogenesis having extra processual parts post-anal tail morphogenesis, abnormal	WT + MO1-dvl2 + MO1-dvl3a	standard conditions	Fig. 3 from Yang et al., 2011
somite increased width, abnormal	WT + MO1-dvl2 + MO1-dvl3a	standard conditions	Fig. 6 from Angers et al., 2006
whole organism decreased length, abnormal	WT + MO1-dvl2 + MO1-dvl3a	standard conditions	Fig. 6 from Angers et al., 2006
post-vent region deformed, abnormal	WT + MO1-dvl2 + MO1-dvl3a	standard conditions	Fig. 3 from Yang et al., 2011
post-anal tail morphogenesis disrupted, abnormal	WT + MO1-dvl2 + MO1-dvl3a	standard conditions	Fig. 3 from Yang et al., 2011
whole organism has extra parts of type post-vent region, abnormal	WT + MO1-dvl2 + MO1-dvl3a	standard conditions	Fig. 3 from Yang et al., 2011
convergent extension disrupted, abnormal	WT + MO1-dvl2 + MO1-dvl3a	standard conditions	Fig. 6 from Angers et al., 2006
post-vent region deformed, abnormal	WT + MO1-dvl3a + MO2-tll1	standard conditions	Fig. 3 from Yang et al., 2011
whole organism has extra parts of type post-vent region, abnormal	WT + MO1-dvl3a + MO2-tll1	standard conditions	Fig. 3 from Yang et al., 2011
post-anal tail morphogenesis disrupted, abnormal	WT + MO1-dvl3a + MO2-tll1	standard conditions	Fig. 3 from Yang et al., 2011
post-anal tail morphogenesis having extra processual parts post-anal tail morphogenesis, abnormal	WT + MO1-dvl3a + MO2-tll1	standard conditions	Fig. 3 from Yang et al., 2011
convergent extension involved in gastrulation process quality, abnormal	WT + MO1-dvl3a + MO3-dvl2	standard conditions	Fig. s8 from Cheng et al., 2017
post-anal tail morphogenesis disrupted, abnormal	tll1^{tc263a/tc263a} + MO1-dvl2 + MO1-dvl3a	standard conditions	Fig. 3 from Yang et al., 2011
whole organism has extra parts of type post-vent region, abnormal	tll1^{tc263a/tc263a} + MO1-dvl2 + MO1-dvl3a	standard conditions	Fig. 3 from Yang et al., 2011
post-anal tail morphogenesis having extra processual parts post-anal tail morphogenesis, abnormal	tll1^{tc263a/tc263a} + MO1-dvl2 + MO1-dvl3a	standard conditions	Fig. 3 from Yang et al., 2011
post-vent region deformed, abnormal	tll1^{tc263a/tc263a} + MO1-dvl2 + MO1-dvl3a	standard conditions	Fig. 3 from Yang et al., 2011
post-anal tail morphogenesis disrupted, abnormal	WT + MO1-cdh2 + MO1-dvl2 + MO1-dvl3a	standard conditions	Fig. 5 from Yang et al., 2011
post-anal tail morphogenesis having extra processual parts post-anal tail morphogenesis, abnormal	WT + MO1-cdh2 + MO1-dvl2 + MO1-dvl3a	standard conditions	Fig. 5 from Yang et al., 2011
post-vent region deformed, abnormal	WT + MO1-cdh2 + MO1-dvl2 + MO1-dvl3a	standard conditions	Fig. 5 from Yang et al., 2011
whole organism has extra parts of type post-vent region, abnormal	WT + MO1-cdh2 + MO1-dvl2 + MO1-dvl3a	standard conditions	Fig. 5 from Yang et al., 2011
establishment of spindle orientation process quality, abnormal	WT + MO1-dvl1b + MO1-dvl2 + MO1-dvl3a	standard conditions	Fig. 6 from Segalen et al., 2010
post-anal tail morphogenesis disrupted, abnormal	WT + MO1-dvl2 + MO1-dvl3a + MO2-tll1	standard conditions	Fig. 3 from Yang et al., 2011
post-vent region deformed, abnormal	WT + MO1-dvl2 + MO1-dvl3a + MO2-tll1	standard conditions	Fig. 3 from Yang et al., 2011
post-anal tail morphogenesis having extra processual parts post-anal tail morphogenesis, abnormal	WT + MO1-dvl2 + MO1-dvl3a + MO2-tll1	standard conditions	Fig. 3 from Yang et al., 2011
whole organism has extra parts of type post-vent region, abnormal	WT + MO1-dvl2 + MO1-dvl3a + MO2-tll1	standard conditions	Fig. 3 from Yang et al., 2011

Citations