Morpholino

MO1-rarab

ID

ZDB-MRPHLNO-060315-5

Name

MO1-rarab

Previous Names

None

Target

Sequence

5' - CCACAACGTCCACGCTCTCGTACAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rarab

Expressed Gene	Anatomy	Figures
egr2b	rhombomere 3 rhombomere 5	Fig. 2 from Linville et al., 2009
fabp10a	liver	Fig. 3 from Garnaas et al., 2012
fgf10a	lateral line primordium otic vesicle (not) pectoral fin field pharyngeal arch	Fig. 4 from He et al., 2011
fgf24	(not) pectoral fin field pharyngeal arch	Fig. 4 from He et al., 2011
hoxb5a	mesoderm neural tube	Fig. 2 from Linville et al., 2009
hoxc6a	(not) pectoral fin field rhombomere 3 rhombomere 5	Fig. 4 from He et al., 2011
ins	pancreas primordium	Fig. 2 from Stafford et al., 2006
lbx1a	central nervous system (not) pectoral fin field	Fig. 4 from He et al., 2011
mafba	rhombomere 5 rhombomere 6	Fig. 2 from Linville et al., 2009
tbx5a	heart rudiment immature eye (not) pectoral fin bud (not) pectoral fin field	Fig. 4 from He et al., 2011 Fig. 5 from Linville et al., 2009

Phenotype

Phenotype resulting from MO1-rarab

Phenotype	Fish	Figures
liver decreased size, abnormal	WT + MO1-rarab	Fig. 3 from Garnaas et al., 2012
pectoral fin absent, abnormal	AB/TU + MO1-rarab	Fig. 4 from He et al., 2011
pectoral fin aplastic, abnormal	WT + MO1-rarab	Fig. 5 from Linville et al., 2009
pectoral fin bud aplastic, abnormal	WT + MO1-rarab	Fig. 5 from Linville et al., 2009
pectoral fin fold endochondral bone absent, abnormal	AB/TU + MO1-rarab	Fig. 4 from He et al., 2011
pectoral fin fold scapulocoracoid absent, abnormal	AB/TU + MO1-rarab	Fig. 4 from He et al., 2011

Phenotype of all Fish created by or utilizing MO1-rarab

Phenotype	Fish	Conditions	Figures
pectoral fin absent, abnormal	AB/TU + MO1-rarab	standard conditions	Fig. 4 from He et al., 2011
pectoral fin fold endochondral bone absent, abnormal	AB/TU + MO1-rarab	standard conditions	Fig. 4 from He et al., 2011
pectoral fin fold scapulocoracoid absent, abnormal	AB/TU + MO1-rarab	standard conditions	Fig. 4 from He et al., 2011
pectoral fin bud aplastic, abnormal	WT + MO1-rarab	standard conditions	Fig. 5 from Linville et al., 2009
liver decreased size, abnormal	WT + MO1-rarab	standard conditions	Fig. 3 from Garnaas et al., 2012
pectoral fin aplastic, abnormal	WT + MO1-rarab	standard conditions	Fig. 5 from Linville et al., 2009
liver decreased size, abnormal	WT + MO1-raraa + MO1-rarab + MO1-rarga + MO1-rargb	standard conditions	Fig. 3 from Garnaas et al., 2012
liver absent, abnormal	WT + MO1-raraa + MO1-rarab + MO1-rarga + MO1-rargb	standard conditions	Fig. 3 from Garnaas et al., 2012
hepatocyte decreased amount, abnormal	zf235Tg + MO1-raraa + MO1-rarab + MO1-rarga + MO1-rargb	standard conditions	Fig. 3 from Garnaas et al., 2012

Citations