header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-060302-3
Morpholino Name: MO1-ptger4a
Target: ptger4a (1)
Previous Names: ep4-MO1 (1), MO1-ptger4l

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - CGCGCTGGAGGTCTGGAGATCGCGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: translation blocker targeted to 5'-UTR
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-ptger4a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-ptger4a
Expressed Gene Anatomy Figures
slc12a1 Fig. 4 with image from Poureetezadi et al., 2016
slc12a3 Fig. 4 with image from Poureetezadi et al., 2016
PHENOTYPE
Phenotype resulting from MO1-ptger4a
Phenotype of all Fish created by or utilizing MO1-ptger4a
Phenotype Fish Conditions Figures
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-ptger4a standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule increased size, abnormal TU + MO1-ptger4a standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule slc12a1 expression increased distribution, abnormal TU + MO1-ptger4a standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule decreased size, abnormal TU + MO1-ptger4a standard conditions Fig. 4 with image from Poureetezadi et al., 2016
exocrine pancreas prss1 expression decreased distribution, abnormal WT + MO1-ptger4a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas size, ameliorated WT + MO1-ptger4a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas prss1 expression amount, ameliorated WT + MO1-ptger4a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal WT + MO1-ptger4a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
hematopoietic stem cell decreased amount, abnormal WT + MO1-ptger4a + MO2-ptger4a standard conditions Fig. S1 from North et al., 2007
liver EGFP expression decreased distribution, abnormal as3Tg + MO1-ptger4a + MO2-ptger4a control Fig. 1 with image from Nissim et al., 2014
liver size, ameliorated as3Tg + MO1-ptger4a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
liver EGFP expression amount, ameliorated as3Tg + MO1-ptger4a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
liver decreased size, abnormal as3Tg + MO1-ptger4a + MO2-ptger4a control Fig. 1 with image from Nissim et al., 2014
exocrine pancreas size, ameliorated zf578Tg + MO1-ptger4a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal zf578Tg + MO1-ptger4a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal WT + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal WT + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas prss1 expression decreased distribution, abnormal WT + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas prss1 expression amount, ameliorated WT + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
liver decreased size, abnormal as3Tg + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
liver decreased size, abnormal as3Tg + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a control Fig. 1 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal zf578Tg + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal zf578Tg + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
OTHER MO1-ptger4a MORPHOLINO PAGES No links to external sites
CITATIONS (4)