ZFIN ID: ZDB-MRPHLNO-060302-2
Morpholino Name: MO2-ptger2a
Target: ptger2a (1)
Previous Names: ep2-MO2 (1), MO2-ptger2l (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACTGTCAATACAGGTCCCATTTTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: translation blocker targeted to start codon
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-ptger2a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-ptger2a
Expressed Gene Anatomy Figures
slc12a1 Fig. 4 with image from Poureetezadi et al., 2016
slc12a3 Fig. 4 with image from Poureetezadi et al., 2016
PHENOTYPE
Phenotype resulting from MO2-ptger2a
Phenotype Figures
pronephric distal early tubule slc12a1 expression increased distribution, abnormal Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule increased size, abnormal Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule decreased size, abnormal Fig. 4 with image from Poureetezadi et al., 2016

Phenotype of all Fish created by or utilizing MO2-ptger2a
Phenotype Fish Conditions Figures
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO2-ptger2a standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule slc12a1 expression increased distribution, abnormal TU + MO2-ptger2a standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal early tubule increased size, abnormal TU + MO2-ptger2a standard conditions Fig. 4 with image from Poureetezadi et al., 2016
pronephric distal late tubule decreased size, abnormal TU + MO2-ptger2a standard conditions Fig. 4 with image from Poureetezadi et al., 2016
exocrine pancreas size, ameliorated WT + MO1-ptger2a + MO2-ptger2a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas prss1 expression decreased distribution, abnormal WT + MO1-ptger2a + MO2-ptger2a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal WT + MO1-ptger2a + MO2-ptger2a control Fig. 2 with image from Nissim et al., 2014
hematopoietic stem cell decreased amount, abnormal WT + MO1-ptger2a + MO2-ptger2a standard conditions Fig. S1 from North et al., 2007
exocrine pancreas prss1 expression amount, ameliorated WT + MO1-ptger2a + MO2-ptger2a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
liver EGFP expression decreased distribution, abnormal as3Tg + MO1-ptger2a + MO2-ptger2a control Fig. 1 with image from Nissim et al., 2014
liver size, ameliorated as3Tg + MO1-ptger2a + MO2-ptger2a chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
liver decreased size, abnormal as3Tg + MO1-ptger2a + MO2-ptger2a control Fig. 1 with image from Nissim et al., 2014
liver EGFP expression amount, ameliorated as3Tg + MO1-ptger2a + MO2-ptger2a chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal WT + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal WT + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas prss1 expression decreased distribution, abnormal WT + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas prss1 expression amount, ameliorated WT + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
liver decreased size, abnormal as3Tg + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 1 with image from Nissim et al., 2014
liver decreased size, abnormal as3Tg + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a control Fig. 1 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal zf578Tg + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a control Fig. 2 with image from Nissim et al., 2014
exocrine pancreas decreased size, abnormal zf578Tg + MO1-ptger2a + MO1-ptger4a + MO2-ptger2a + MO2-ptger4a chemical treatment: prostaglandin E2 Fig. 2 with image from Nissim et al., 2014
OTHER MO2-ptger2a MORPHOLINO PAGESNo links to external sites
CITATIONS (6)