Morpholino

MO2-lef1

ID
ZDB-MRPHLNO-060214-6
Name
MO2-lef1
Previous Names
None
Target
Sequence
5' - ACTGCCTGGATGAAACACTTACATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-lef1
Phenotype
Phenotype resulting from MO2-lef1
Phenotype Fish Figures
brain wholly posteriorized, abnormal WT + MO2-lef1 Fig. 6 with image from Nyholm et al., 2007
cartilage morphogenesis disrupted, abnormal WT + MO2-lef1 Fig. 1 from Ishitani et al., 2005
cell proliferation in midbrain decreased occurrence, abnormal WT + MO2-lef1 Fig. 2 from Ota et al., 2012
cranial cartilage morphology, abnormal WT + MO2-lef1 Fig. 1 from Ishitani et al., 2005
diencephalon dopaminergic neuron increased amount, abnormal WT + MO2-lef1 Fig. 8 with imageFig. S6 with image from Russek-Blum et al., 2008
dorsal root ganglion decreased amount, abnormal WT + MO2-lef1 Fig. 1 from Ishitani et al., 2005
dorsal root ganglion mislocalised, abnormal WT + MO2-lef1 Fig. 1 from Ishitani et al., 2005
forebrain neuron development disrupted, abnormal WT + MO2-lef1 Fig. 4 with image from Lee et al., 2006
hypothalamus axon decreased amount, abnormal WT + MO2-lef1 Fig. 5 with image from Lee et al., 2006
hypothalamus neuron decreased amount, abnormal WT + MO2-lef1 Fig. 5 with image from Lee et al., 2006
hypothalamus neuron morphology, abnormal WT + MO2-lef1 Fig. 4 with image from Lee et al., 2006
hypothalamus cell differentiation disrupted, abnormal WT + MO2-lef1 Fig. 5 with image from Lee et al., 2006
mandibular arch skeleton decreased size, abnormal WT + MO2-lef1 Fig. 1 from Ishitani et al., 2005
midbrain morphology, abnormal WT + MO2-lef1 Fig. 6 with image from Nyholm et al., 2007
midbrain development disrupted, abnormal rw0130aTg + MO2-lef1 Fig. 2 from Ota et al., 2012
neural crest cell development disrupted, abnormal WT + MO2-lef1 Fig. 1 from Ishitani et al., 2005
optic tectum decreased size, abnormal rw0130aTg + MO2-lef1 Fig. 2 from Ota et al., 2012
Phenotype of all Fish created by or utilizing MO2-lef1
Phenotype Fish Conditions Figures
brain wholly posteriorized, abnormal WT + MO2-lef1 standard conditions Fig. 6 with image from Nyholm et al., 2007
dorsal root ganglion decreased amount, abnormal WT + MO2-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
dorsal root ganglion mislocalised, abnormal WT + MO2-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
neural crest cell development disrupted, abnormal WT + MO2-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
cranial cartilage morphology, abnormal WT + MO2-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
midbrain morphology, abnormal WT + MO2-lef1 standard conditions Fig. 6 with image from Nyholm et al., 2007
hypothalamus cell differentiation disrupted, abnormal WT + MO2-lef1 standard conditions Fig. 5 with image from Lee et al., 2006
diencephalon dopaminergic neuron increased amount, abnormal WT + MO2-lef1 standard conditions Fig. 8 with imageFig. S6 with image from Russek-Blum et al., 2008
hypothalamus neuron decreased amount, abnormal WT + MO2-lef1 standard conditions Fig. 5 with image from Lee et al., 2006
mandibular arch skeleton decreased size, abnormal WT + MO2-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
hypothalamus neuron morphology, abnormal WT + MO2-lef1 standard conditions Fig. 4 with image from Lee et al., 2006
forebrain neuron development disrupted, abnormal WT + MO2-lef1 standard conditions Fig. 4 with image from Lee et al., 2006
cartilage morphogenesis disrupted, abnormal WT + MO2-lef1 standard conditions Fig. 1 from Ishitani et al., 2005
hypothalamus axon decreased amount, abnormal WT + MO2-lef1 standard conditions Fig. 5 with image from Lee et al., 2006
cell proliferation in midbrain decreased occurrence, abnormal WT + MO2-lef1 standard conditions Fig. 2 from Ota et al., 2012
midbrain development disrupted, abnormal rw0130aTg + MO2-lef1 standard conditions Fig. 2 from Ota et al., 2012
optic tectum decreased size, abnormal rw0130aTg + MO2-lef1 standard conditions Fig. 2 from Ota et al., 2012
midbrain development disrupted, abnormal rw0130aTg + MO2-lef1 + MO4-tp53 standard conditions Fig. 2 from Ota et al., 2012
optic tectum decreased size, abnormal rw0130aTg + MO2-lef1 + MO4-tp53 standard conditions Fig. 2 from Ota et al., 2012
retina development in camera-type eye disrupted, abnormal apchu745/hu745 + MO2-lef1 standard conditions Fig. 5 with image from Rai et al., 2010
retina immature, abnormal apchu745/hu745 + MO2-lef1 standard conditions Fig. 5 with image from Rai et al., 2010
Citations