Morpholino

MO1-ptena

ID
ZDB-MRPHLNO-060214-1
Name
MO1-ptena
Previous Names
None
Target
Sequence
5' - CCTCGCTCACCCTTGACTGTGTATG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ptena
No data available
Phenotype
Phenotype resulting from MO1-ptena
Phenotype Fish Figures
blood decreased fluid flow, abnormal WT + MO1-ptena Fig. 5 with image from Croushore et al., 2005
eye decreased size, abnormal WT + MO1-ptena Fig. 5 with image from Croushore et al., 2005
head domed, abnormal WT + MO1-ptena Fig. 5 with image from Croushore et al., 2005
head mislocalised ventrally, abnormal WT + MO1-ptena Fig. 5 with image from Croushore et al., 2005
inner ear epithelial cell aggregated, abnormal WT + MO1-ptena Fig. 6 with image from Croushore et al., 2005
inner ear epithelial cell disorganized, abnormal WT + MO1-ptena Fig. 6 with image from Croushore et al., 2005
intersegmental vessel malformed, abnormal WT + MO1-ptena Fig. 5 with image from Croushore et al., 2005
intersegmental vessel shape, abnormal WT + MO1-ptena Fig. 5 with image from Croushore et al., 2005
lipid phosphatase activity disrupted, abnormal WT + MO1-ptena Fig. 8 with image from Croushore et al., 2005
notochord undulate, abnormal WT + MO1-ptena Fig. 5 with image from Croushore et al., 2005
oligodendrocyte myelin sheath increased length, abnormal co18Tg; co19Tg + MO1-ptena + MO4-tp53 Fig. 7 from Mathews et al., 2016
oligodendrocyte TOR signaling increased occurrence, abnormal vu12Tg + MO1-ptena + MO4-tp53 Fig. 3 from Mathews et al., 2016
otolith decreased amount, abnormal WT + MO1-ptena Fig. 6 with image from Croushore et al., 2005
otolith shape, abnormal WT + MO1-ptena Fig. 6 with image from Croushore et al., 2005
pericardium edematous, abnormal WT + MO1-ptena Fig. 5 with image from Croushore et al., 2005
phosphatidylinositol dephosphorylation decreased occurrence, abnormal WT + MO1-ptena Fig. 8 with image from Croushore et al., 2005
pillar of the semicircular canal unfused from pillar of the semicircular canal, abnormal WT + MO1-ptena Fig. 6 with image from Croushore et al., 2005
post-vent region curved ventral, abnormal WT + MO1-ptena Fig. 5 with image from Croushore et al., 2005
semicircular canal formation disrupted, abnormal WT + MO1-ptena Fig. 6 with image from Croushore et al., 2005
spinal cord oligodendrocyte ab1-rps6 labeling increased amount, abnormal vu12Tg + MO1-ptena + MO4-tp53 Fig. 3 from Mathews et al., 2016
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-ptena Fig. 5 with image from Croushore et al., 2005
Phenotype of all Fish created by or utilizing MO1-ptena
Phenotype Fish Conditions Figures
inner ear epithelial cell aggregated, abnormal WT + MO1-ptena standard conditions Fig. 6 with image from Croushore et al., 2005
pillar of the semicircular canal unfused from pillar of the semicircular canal, abnormal WT + MO1-ptena standard conditions Fig. 6 with image from Croushore et al., 2005
head domed, abnormal WT + MO1-ptena standard conditions Fig. 5 with image from Croushore et al., 2005
notochord undulate, abnormal WT + MO1-ptena standard conditions Fig. 5 with image from Croushore et al., 2005
post-vent region curved ventral, abnormal WT + MO1-ptena standard conditions Fig. 5 with image from Croushore et al., 2005
lipid phosphatase activity disrupted, abnormal WT + MO1-ptena standard conditions Fig. 8 with image from Croushore et al., 2005
intersegmental vessel shape, abnormal WT + MO1-ptena standard conditions Fig. 5 with image from Croushore et al., 2005
intersegmental vessel malformed, abnormal WT + MO1-ptena standard conditions Fig. 5 with image from Croushore et al., 2005
pericardium edematous, abnormal WT + MO1-ptena standard conditions Fig. 5 with image from Croushore et al., 2005
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-ptena standard conditions Fig. 5 with image from Croushore et al., 2005
inner ear epithelial cell disorganized, abnormal WT + MO1-ptena standard conditions Fig. 6 with image from Croushore et al., 2005
otolith decreased amount, abnormal WT + MO1-ptena standard conditions Fig. 6 with image from Croushore et al., 2005
semicircular canal formation disrupted, abnormal WT + MO1-ptena standard conditions Fig. 6 with image from Croushore et al., 2005
phosphatidylinositol dephosphorylation decreased occurrence, abnormal WT + MO1-ptena standard conditions Fig. 8 with image from Croushore et al., 2005
blood decreased fluid flow, abnormal WT + MO1-ptena standard conditions Fig. 5 with image from Croushore et al., 2005
head mislocalised ventrally, abnormal WT + MO1-ptena standard conditions Fig. 5 with image from Croushore et al., 2005
eye decreased size, abnormal WT + MO1-ptena standard conditions Fig. 5 with image from Croushore et al., 2005
otolith shape, abnormal WT + MO1-ptena standard conditions Fig. 6 with image from Croushore et al., 2005
spinal cord oligodendrocyte ab1-rps6 labeling increased amount, abnormal vu12Tg + MO1-ptena + MO4-tp53 standard conditions Fig. 3 from Mathews et al., 2016
oligodendrocyte TOR signaling increased occurrence, abnormal vu12Tg + MO1-ptena + MO4-tp53 standard conditions Fig. 3 from Mathews et al., 2016
oligodendrocyte myelin sheath length, ameliorated co18Tg; co19Tg + MO1-ptena + MO4-tp53 chemical treatment by environment: U0126 Fig. 7 from Mathews et al., 2016
oligodendrocyte myelin sheath decreased length, ameliorated co18Tg; co19Tg + MO1-ptena + MO4-tp53 chemical treatment by environment: sirolimus Fig. 7 from Mathews et al., 2016
oligodendrocyte myelin sheath increased length, abnormal co18Tg; co19Tg + MO1-ptena + MO4-tp53 control Fig. 7 from Mathews et al., 2016
hindbrain oligodendrocyte development process quality, ameliorated hmgcs1vu57/vu57 + MO1-ptena + MO4-tp53 control Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte development decreased process quality, abnormal hmgcs1vu57/vu57 + MO1-ptena + MO4-tp53 chemical treatment by environment: sirolimus Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte mbpa expression amount, ameliorated hmgcs1vu57/vu57 + MO1-ptena + MO4-tp53 control Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte mbpa expression decreased amount, abnormal hmgcs1vu57/vu57 + MO1-ptena + MO4-tp53 chemical treatment by environment: sirolimus Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte plp1a expression amount, ameliorated hmgcs1vu57/vu57 + MO1-ptena + MO4-tp53 chemical treatment by environment: U0126 Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte plp1a expression decreased amount, abnormal hmgcs1vu57/vu57 + MO1-ptena + MO4-tp53 chemical treatment by environment: sirolimus Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte plp1a expression amount, ameliorated hmgcs1vu57/vu57 + MO1-ptena + MO4-tp53 control Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte development process quality, ameliorated hmgcs1vu57/vu57 + MO1-ptena + MO4-tp53 chemical treatment by environment: U0126 Fig. 4 from Mathews et al., 2016
hindbrain oligodendrocyte mbpa expression amount, ameliorated hmgcs1vu57/vu57 + MO1-ptena + MO4-tp53 chemical treatment by environment: U0126 Fig. 4 from Mathews et al., 2016
oligodendrocyte TOR signaling occurrence, ameliorated hmgcs1vu57/vu57; vu12Tg + MO1-ptena + MO4-tp53 standard conditions Fig. 3 from Mathews et al., 2016
spinal cord oligodendrocyte ab1-rps6 labeling amount, ameliorated hmgcs1vu57/vu57; vu12Tg + MO1-ptena + MO4-tp53 standard conditions Fig. 3 from Mathews et al., 2016
spinal cord oligodendrocyte ab20-mapk labeling increased amount, abnormal hmgcs1vu57/vu57; vu12Tg + MO1-ptena + MO4-tp53 standard conditions Fig. 3 from Mathews et al., 2016
oligodendrocyte MAPK cascade decreased occurrence, abnormal hmgcs1vu57/vu57; vu12Tg + MO1-ptena + MO4-tp53 standard conditions Fig. 3 from Mathews et al., 2016
spinal cord central nervous system myelination occurrence, ameliorated hmgcs1vu57/vu57; vu16Tg + MO1-ptena + MO4-tp53 chemical treatment by environment: U0126 Fig. 6 from Mathews et al., 2016
spinal cord central nervous system myelination occurrence, ameliorated hmgcs1vu57/vu57; vu16Tg + MO1-ptena + MO4-tp53 control Fig. 5Fig. 6 from Mathews et al., 2016
spinal cord central nervous system myelination occurrence, ameliorated hmgcs1vu57/vu57; vu16Tg + MO1-ptena + MO4-tp53 chemical treatment by environment: sirolimus Fig. 6 from Mathews et al., 2016
Citations