Morpholino

MO1-bbs4

ID
ZDB-MRPHLNO-060208-1
Name
MO1-bbs4
Previous Names
None
Target
Sequence
5' - GAAAAAGATCACTACTGTAAAGCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bbs4
No data available
Phenotype
Phenotype resulting from MO1-bbs4
Phenotype Fish Figures
axis decreased length, abnormal WT + MO1-bbs4 Fig. 6 with image from Li et al., 2008
cell detached from neural tube, abnormal WT + MO1-bbs4 Fig. 3 from Badano et al., 2006
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-bbs4 Fig. 1 from Gerdes et al., 2007
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-bbs4 Fig. 2 from Gerdes et al., 2007
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-bbs4 Fig. 7 from Lopes et al., 2011
gastrulation disrupted, abnormal WT + MO1-bbs4 Fig. 1 with imageFig. S4 with image from Zaghloul et al., 2010
mandibular arch skeleton decreased length, abnormal WT + MO1-bbs4 Fig. 2 with image from Tobin et al., 2008
mandibular arch skeleton increased width, abnormal WT + MO1-bbs4 Fig. 2 with image from Tobin et al., 2008
notochord increased width, abnormal WT + MO1-bbs4 Fig. 1 with image from Zaghloul et al., 2010
Fig. 6 with image from Li et al., 2008
Fig. 1 from Gerdes et al., 2007
Fig. S4Fig. S7 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
notochord kinked, abnormal WT + MO1-bbs4 Fig. 4 with image from Wang et al., 2011
Fig. 1 with imageFig. S4 with image from Zaghloul et al., 2010
Fig. 1 from Gerdes et al., 2007
Fig. 3Fig. S4Fig. S7 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
pancreatic A cell gcga expression decreased amount, abnormal TU + MO1-bbs4 Fig. 2 from Lodh et al., 2016
pancreatic B cell mCherry expression decreased amount, abnormal jh2Tg + MO1-bbs4 Fig. 1 from Lodh et al., 2016
pancreatic B cell increased amount, abnormal jh2Tg + MO1-bbs4 Fig. 1 from Lodh et al., 2016
pancreatic bud isl1a expression decreased amount, abnormal TU + MO1-bbs4 Fig. 2 from Lodh et al., 2016
pancreatic bud neurod1 expression decreased amount, abnormal TU + MO1-bbs4 Fig. 2 from Lodh et al., 2016
pancreatic bud pdx1 expression decreased amount, abnormal TU + MO1-bbs4 Fig. 2 from Lodh et al., 2016
pancreatic D cell sst1.1 expression decreased amount, abnormal TU + MO1-bbs4 Fig. 2 from Lodh et al., 2016
photoreceptor cell outer segment organization disrupted, abnormal AB/EKW + MO1-bbs4 Fig. 4 with image from Wang et al., 2011
photoreceptor inner segment layer structure, abnormal AB/EKW + MO1-bbs4 Fig. 4 with image from Wang et al., 2011
post-vent region morphology, abnormal WT + MO1-bbs4 Fig. S4 from Badano et al., 2006
rhodopsin metabolic process disrupted, abnormal AB/EKW + MO1-bbs4 Fig. 4 with image from Wang et al., 2011
somite amorphous, abnormal WT + MO1-bbs4 Fig. 2 from Stoetzel et al., 2006
somite decreased thickness, abnormal WT + MO1-bbs4 Fig. 6 with image from Li et al., 2008
somite elongated, abnormal WT + MO1-bbs4 Fig. 6 with image from Li et al., 2008
somite increased length, abnormal WT + MO1-bbs4 Fig. 1 from Gerdes et al., 2007
Fig. 2 from Stoetzel et al., 2006
somite increased width, abnormal WT + MO1-bbs4 Fig. 4 with image from Wang et al., 2011
Fig. 1 with imageFig. S4 with image from Zaghloul et al., 2010
Fig. 3Fig. S4Fig. S7 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
somite shape, abnormal WT + MO1-bbs4 Fig. 1 from Gerdes et al., 2007
Fig. S4 from Badano et al., 2006
somite border amorphous, abnormal WT + MO1-bbs4 Fig. S4 from Badano et al., 2006
whole organism decreased length, abnormal WT + MO1-bbs4 Fig. 1 from Gerdes et al., 2007
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs4 Fig. 4 with image from Wang et al., 2011
Fig. 1 with imageFig. S4 with image from Zaghloul et al., 2010
Fig. 3Fig. S4Fig. S7 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
whole organism dorsal side decreased thickness, abnormal WT + MO1-bbs4 Fig. 3 from Badano et al., 2006
Phenotype of all Fish created by or utilizing MO1-bbs4
Phenotype Fish Conditions Figures
rhodopsin metabolic process disrupted, abnormal AB/EKW + MO1-bbs4 standard conditions Fig. 4 with image from Wang et al., 2011
photoreceptor inner segment layer structure, abnormal AB/EKW + MO1-bbs4 standard conditions Fig. 4 with image from Wang et al., 2011
whole organism anterior-posterior axis decreased length, abnormal AB/EKW + MO1-bbs4 standard conditions Fig. 4 with image from Wang et al., 2011
somite increased width, abnormal AB/EKW + MO1-bbs4 standard conditions Fig. 4 with image from Wang et al., 2011
photoreceptor cell outer segment organization disrupted, abnormal AB/EKW + MO1-bbs4 standard conditions Fig. 4 with image from Wang et al., 2011
notochord kinked, abnormal AB/EKW + MO1-bbs4 standard conditions Fig. 4 with image from Wang et al., 2011
pancreatic A cell gcga expression decreased amount, abnormal TU + MO1-bbs4 standard conditions Fig. 2 from Lodh et al., 2016
pancreatic bud neurod1 expression decreased amount, abnormal TU + MO1-bbs4 standard conditions Fig. 2 from Lodh et al., 2016
pancreatic D cell sst1.1 expression decreased amount, abnormal TU + MO1-bbs4 standard conditions Fig. 2 from Lodh et al., 2016
pancreatic bud pdx1 expression decreased amount, abnormal TU + MO1-bbs4 standard conditions Fig. 2 from Lodh et al., 2016
pancreatic bud isl1a expression decreased amount, abnormal TU + MO1-bbs4 standard conditions Fig. 2 from Lodh et al., 2016
notochord kinked, abnormal WT + MO1-bbs4 standard conditions Fig. 1 with imageFig. S4 with image from Zaghloul et al., 2010
Fig. 1 from Gerdes et al., 2007
Fig. 3Fig. S4Fig. S7 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
convergent extension involved in axis elongation disrupted, abnormal WT + MO1-bbs4 standard conditions Fig. 1 from Gerdes et al., 2007
somite border amorphous, abnormal WT + MO1-bbs4 standard conditions Fig. S4 from Badano et al., 2006
mandibular arch skeleton increased width, abnormal WT + MO1-bbs4 standard conditions Fig. 2 with image from Tobin et al., 2008
gastrulation disrupted, abnormal WT + MO1-bbs4 standard conditions Fig. 1 with imageFig. S4 with image from Zaghloul et al., 2010
notochord increased width, abnormal WT + MO1-bbs4 standard conditions Fig. 1 with image from Zaghloul et al., 2010
Fig. 6 with image from Li et al., 2008
Fig. 1 from Gerdes et al., 2007
Fig. S4Fig. S7 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
cell detached from neural tube, abnormal WT + MO1-bbs4 standard conditions Fig. 3 from Badano et al., 2006
somite increased width, abnormal WT + MO1-bbs4 standard conditions Fig. 1 with imageFig. S4 with image from Zaghloul et al., 2010
Fig. 3Fig. S4Fig. S7 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
convergent extension involved in gastrulation disrupted, abnormal WT + MO1-bbs4 standard conditions Fig. 2 from Gerdes et al., 2007
somite elongated, abnormal WT + MO1-bbs4 standard conditions Fig. 6 with image from Li et al., 2008
axis decreased length, abnormal WT + MO1-bbs4 standard conditions Fig. 6 with image from Li et al., 2008
somite shape, abnormal WT + MO1-bbs4 standard conditions Fig. 1 from Gerdes et al., 2007
Fig. S4 from Badano et al., 2006
somite decreased thickness, abnormal WT + MO1-bbs4 standard conditions Fig. 6 with image from Li et al., 2008
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs4 standard conditions Fig. 1 with imageFig. S4 with image from Zaghloul et al., 2010
Fig. 3Fig. S4Fig. S7 from Badano et al., 2006
Fig. 2 from Stoetzel et al., 2006
somite amorphous, abnormal WT + MO1-bbs4 standard conditions Fig. 2 from Stoetzel et al., 2006
whole organism dorsal side decreased thickness, abnormal WT + MO1-bbs4 standard conditions Fig. 3 from Badano et al., 2006
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-bbs4 standard conditions Fig. 7 from Lopes et al., 2011
somite increased length, abnormal WT + MO1-bbs4 standard conditions Fig. 1 from Gerdes et al., 2007
Fig. 2 from Stoetzel et al., 2006
mandibular arch skeleton decreased length, abnormal WT + MO1-bbs4 standard conditions Fig. 2 with image from Tobin et al., 2008
post-vent region morphology, abnormal WT + MO1-bbs4 standard conditions Fig. S4 from Badano et al., 2006
whole organism decreased length, abnormal WT + MO1-bbs4 standard conditions Fig. 1 from Gerdes et al., 2007
pancreatic B cell mCherry expression decreased amount, abnormal jh2Tg + MO1-bbs4 standard conditions Fig. 1 from Lodh et al., 2016
pancreatic B cell increased amount, abnormal jh2Tg + MO1-bbs4 standard conditions Fig. 1 from Lodh et al., 2016
whole organism anterior-posterior axis decreased length, abnormal vangl2m209/m209 + MO1-bbs4 standard conditions Fig. 5 from Ross et al., 2005
neural rod increased width, abnormal vangl2m209/m209 + MO1-bbs4 standard conditions Fig. 5 from Ross et al., 2005
somite antero-posteriorly flattened, abnormal vangl2m209/m209 + MO1-bbs4 standard conditions Fig. 5 from Ross et al., 2005
presumptive rhombomere 5 decreased distance somite 1, abnormal vangl2m209/m209 + MO1-bbs4 standard conditions Fig. 5 from Ross et al., 2005
convergent extension involved in axis elongation disrupted, abnormal wnt5bta98/+ + MO1-bbs4 standard conditions Fig. 1 from Gerdes et al., 2007
somite increased length, abnormal wnt5bta98/+ + MO1-bbs4 standard conditions Fig. 1 from Gerdes et al., 2007
somite shape, abnormal wnt5bta98/+ + MO1-bbs4 standard conditions Fig. 1 from Gerdes et al., 2007
notochord kinked, abnormal wnt5bta98/+ + MO1-bbs4 standard conditions Fig. 1 from Gerdes et al., 2007
whole organism decreased length, abnormal wnt5bta98/+ + MO1-bbs4 standard conditions Fig. 1 from Gerdes et al., 2007
notochord increased width, abnormal wnt5bta98/+ + MO1-bbs4 standard conditions Fig. 1 from Gerdes et al., 2007
somite increased length, abnormal wnt11f2tx226/+ + MO1-bbs4 standard conditions Fig. 1 from Gerdes et al., 2007
convergent extension involved in axis elongation disrupted, abnormal wnt11f2tx226/+ + MO1-bbs4 standard conditions Fig. 1 from Gerdes et al., 2007
somite shape, abnormal wnt11f2tx226/+ + MO1-bbs4 standard conditions Fig. 1 from Gerdes et al., 2007
notochord kinked, abnormal wnt11f2tx226/+ + MO1-bbs4 standard conditions Fig. 1 from Gerdes et al., 2007
whole organism decreased length, abnormal wnt11f2tx226/+ + MO1-bbs4 standard conditions Fig. 1 from Gerdes et al., 2007
notochord increased width, abnormal wnt11f2tx226/+ + MO1-bbs4 standard conditions Fig. 1 from Gerdes et al., 2007
whole organism anterior-posterior axis decreased length, abnormal AB + MO1-bbs4 + MO1-ift80 standard conditions Fig. 7 from Hudak et al., 2010
notochord kinked, abnormal WT + MO1-bbs4 + MO1-ccdc28b standard conditions Fig. 3Fig. S7 from Badano et al., 2006
somite increased width, abnormal WT + MO1-bbs4 + MO1-ccdc28b standard conditions Fig. 3Fig. S7 from Badano et al., 2006
post-vent region morphology, abnormal WT + MO1-bbs4 + MO1-ccdc28b standard conditions Fig. S7 from Badano et al., 2006
somite border amorphous, abnormal WT + MO1-bbs4 + MO1-ccdc28b standard conditions Fig. S7 from Badano et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs4 + MO1-ccdc28b standard conditions Fig. 3Fig. S7 from Badano et al., 2006
cell detached from neural tube, abnormal WT + MO1-bbs4 + MO1-ccdc28b standard conditions Fig. 3 from Badano et al., 2006
somite shape, abnormal WT + MO1-bbs4 + MO1-ccdc28b standard conditions Fig. 3Fig. S7 from Badano et al., 2006
notochord increased width, abnormal WT + MO1-bbs4 + MO1-ccdc28b standard conditions Fig. 3Fig. S7 from Badano et al., 2006
determination of heart left/right asymmetry disrupted, abnormal WT + MO1-bbs4 + MO1-ofd1 standard conditions Fig. 7 from Lopes et al., 2011
whole organism increased curvature, abnormal WT + MO1-bbs4 + MO1-ofd1 standard conditions Fig. 7 from Lopes et al., 2011
eye decreased distance eye, abnormal WT + MO1-bbs4 + MO2-ift54 standard conditions Fig. 6 with image from Li et al., 2008
somite decreased thickness, abnormal WT + MO1-bbs4 + MO2-ift54 standard conditions Fig. 6 with image from Li et al., 2008
notochord increased width, abnormal WT + MO1-bbs4 + MO2-ift54 standard conditions Fig. 6 with image from Li et al., 2008
axis decreased length, abnormal WT + MO1-bbs4 + MO2-ift54 standard conditions Fig. 6 with image from Li et al., 2008
somite elongated, abnormal WT + MO1-bbs4 + MO2-ift54 standard conditions Fig. 6 with image from Li et al., 2008
notochord increased width, abnormal WT + MO1-bbs10 + MO1-bbs4 standard conditions Fig. 2 from Stoetzel et al., 2006
somite amorphous, abnormal WT + MO1-bbs10 + MO1-bbs4 standard conditions Fig. 2 from Stoetzel et al., 2006
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs10 + MO1-bbs4 standard conditions Fig. 2 from Stoetzel et al., 2006
somite increased width, abnormal WT + MO1-bbs10 + MO1-bbs4 standard conditions Fig. 2 from Stoetzel et al., 2006
somite increased length, abnormal WT + MO1-bbs10 + MO1-bbs4 standard conditions Fig. 2 from Stoetzel et al., 2006
notochord kinked, abnormal WT + MO1-bbs10 + MO1-bbs4 standard conditions Fig. 2 from Stoetzel et al., 2006
cell detached from neural tube, abnormal WT + MO1-bbs10 + MO1-bbs4 standard conditions Fig. 2 from Stoetzel et al., 2006
Citations