ZFIN ID: ZDB-MRPHLNO-051128-8
Morpholino Name: MO2-vegfaa
Target: vegfaa (1)
Previous Names: MO2-vegf, MO2-vegfa, VEGF-A-3 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TAAGAAAGCGAAGCTGCTGGGTATG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-vegfaa No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-vegfaa
Expressed Gene Anatomy Figures
nkx2.4b Fig. 2 with imagetext only from Alt et al., 2006
tie1 Fig. 2 with image from Alt et al., 2006
PHENOTYPE
Phenotype resulting from MO2-vegfaa
Phenotype of all Fish created by or utilizing MO2-vegfaa
Genome Resources: MODB:15 (2)
CITATIONS (11)