Morpholino

MO1-smn1

ID
ZDB-MRPHLNO-051026-3
Name
MO1-smn1
Previous Names
None
Target
Sequence
5' - CGACATCTTCTGCACCATTGGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-smn1
No data available
Phenotype
Phenotype resulting from MO1-smn1
Phenotype Fish Figures
ATP biosynthetic process decreased efficacy, abnormal WT + MO1-smn1 Fig. 2 from Boyd et al., 2017
axon extension process quality, abnormal WT + MO1-smn1 Fig. 7 with image from Chitramuthu et al., 2010
axonogenesis disrupted, abnormal ml2Tg + MO1-smn1 Fig. 5 from Sleigh et al., 2014
Fig. 4 from Oprea et al., 2008
CaP motoneuron morphology, abnormal AB + MO1-smn1 Fig. 4 from McWhorter et al., 2008
CaP motoneuron axon branched, abnormal WT + MO1-smn1 Fig. 4 from See et al., 2014
Fig. 7 with image from Chitramuthu et al., 2010
CaP motoneuron axon decreased length, abnormal WT + MO1-smn1 Fig. 3 from Riessland et al., 2017
Fig. 7 with image from Chitramuthu et al., 2010
Fig. 1 from McWhorter et al., 2003
CaP motoneuron axon increased branchiness, abnormal AB + MO1-smn1 Fig. 3 from Riessland et al., 2017
Fig. 1 from McWhorter et al., 2003
CaP motoneuron axon truncated, abnormal WT + MO1-smn1 Fig. 4 from See et al., 2014
CaP motoneuron axon extension involved in axon guidance decreased process quality, abnormal ml2Tg + MO1-smn1 Fig. 3 from Riessland et al., 2017
CaP motoneuron collateral sprouting increased occurrence, abnormal ml2Tg + MO1-smn1 Fig. 3 from Riessland et al., 2017
cell Cajal body decreased amount, abnormal AB + MO1-smn1 Fig. 8 from Strzelecka et al., 2010
cell Cajal body ab1-coil labeling decreased amount, abnormal AB + MO1-smn1 Fig. 8 from Strzelecka et al., 2010
cell Cajal body ab1-tmg labeling decreased amount, abnormal AB + MO1-smn1 Fig. 8 from Strzelecka et al., 2010
cell small nuclear ribonucleoprotein complex dispersed, abnormal AB + MO1-smn1 Fig. 8 from Strzelecka et al., 2010
fast muscle cell neuromuscular junction decreased width, abnormal ml2Tg + MO1-smn1 Fig. 3 from Riessland et al., 2017
fast muscle cell neuromuscular junction development decreased process quality, abnormal ml2Tg + MO1-smn1 Fig. 3 from Riessland et al., 2017
fast muscle cell neuromuscular synaptic transmission decreased process quality, abnormal ml2Tg + MO1-smn1 Fig. 3 from Riessland et al., 2017
fast muscle cell synaptic cleft decreased width, abnormal ml2Tg + MO1-smn1 Fig. 3 from Riessland et al., 2017
motor neuron decreased amount, abnormal ml2Tg + MO1-smn1 Fig. 5 from Sleigh et al., 2014
motor neuron axon absent, abnormal ml2Tg + MO1-smn1 Fig. 5 from Sleigh et al., 2014
motor neuron axon bifurcated, abnormal ml2Tg + MO1-smn1 Fig. 5 from Sleigh et al., 2014
motor neuron axon branched, abnormal zf35Tg + MO1-smn1 Fig. 1 from Lyon et al., 2014
Fig. 2Fig. 3 from McWhorter et al., 2003
motor neuron axon branchiness, abnormal vu12Tg + MO1-smn1 Fig. 1 from Powis et al., 2016
Fig. 5 from Miller et al., 2015
Fig. 6 from Wishart et al., 2014
Fig. 5 from Winkler et al., 2005
motor neuron axon decreased length, abnormal vu12Tg + MO1-smn1 Fig. 2 from Edens et al., 2015
motor neuron axon increased branchiness, abnormal AB + MO1-smn1 Fig. 8 from Hosseinibarkooie et al., 2016
Fig. 2 from Edens et al., 2015
Table S9 from Van Hoecke et al., 2012
Fig. 4 from McWhorter et al., 2003
motor neuron axon mislocalised, abnormal os26Tg + MO1-smn1 Fig. 6 with image from Lotti et al., 2012
motor neuron axon morphology, abnormal os26Tg + MO1-smn1 Fig. 1 from Powis et al., 2016
Fig. 2 with image from McGovern et al., 2015
Fig. 5 from Miller et al., 2015
Fig. 5 from Wiley et al., 2014
Fig. 4 from Oprea et al., 2008
motor neuron axon truncated, abnormal ml2Tg + MO1-smn1 Fig. 8 from Hosseinibarkooie et al., 2016
Fig. 1 from Powis et al., 2016
Fig. 5 from Miller et al., 2015
Fig. 1 from Lyon et al., 2014
Fig. 5 from Sleigh et al., 2014
Fig. 6 from Wishart et al., 2014
Fig. S8Table S9 from Van Hoecke et al., 2012
Fig. 5 from Winkler et al., 2005
Fig. 2Fig. 3Fig. 4 from McWhorter et al., 2003
motor neuron axon extension disrupted, abnormal os26Tg + MO1-smn1 Fig. 2 with image from McGovern et al., 2015
motor neuron axon extension process quality, abnormal vu12Tg + MO1-smn1 Fig. 2 from Edens et al., 2015
motor neuron axon guidance decreased process quality, abnormal os26Tg + MO1-smn1 Fig. 6 with image from Lotti et al., 2012
motor neuron axon guidance disrupted, abnormal ml2Tg + MO1-smn1 Fig. 5 from Sleigh et al., 2014
mRNA splicing, via spliceosome decreased process quality, abnormal WT + MO1-smn1 Fig. 2 from See et al., 2014
primary motor neuron axon decreased length, abnormal ml2Tg + MO1-smn1 Fig. 3 with imageFig. 5 with imageFig. 6 with image from Boyd et al., 2017
primary motor neuron axon terminus swollen, abnormal WT + MO1-smn1 Fig. 5 with imageFig. 6 with image from Boyd et al., 2017
primary motor neuron axonogenesis disrupted, abnormal ml2Tg + MO1-smn1 Fig. 3 with imageFig. 5 with imageFig. 6 with image from Boyd et al., 2017
swimming decreased rate, abnormal ml2Tg + MO1-smn1 Fig. S3 from Riessland et al., 2017
swimming behavior process quality, abnormal ml2Tg + MO1-smn1 Fig. 1 from Powis et al., 2016
whole organism smn1 expression decreased amount, abnormal AB + MO1-smn1 Fig. 3 from Riessland et al., 2017
Fig. 1 from Powis et al., 2016
whole organism Ab2-atp5a labeling decreased amount, abnormal WT + MO1-smn1 Fig. 2 from Boyd et al., 2017
whole organism Ab3-ub labeling decreased amount, abnormal AB + MO1-smn1 Fig. 1 from Powis et al., 2016
whole organism aerobic respiration decreased efficacy, abnormal WT + MO1-smn1 Fig. 2 from Boyd et al., 2017
whole organism mitochondrion decreased functionality, abnormal WT + MO1-smn1 Fig. 2 from Boyd et al., 2017
Phenotype of all Fish created by or utilizing MO1-smn1
Phenotype Fish Conditions Figures
motor neuron axon truncated, abnormal AB + MO1-smn1 standard conditions Fig. S8Table S9 from Van Hoecke et al., 2012
Fig. 2 from McWhorter et al., 2003
motor neuron axon branched, abnormal AB + MO1-smn1 standard conditions Fig. 2 from McWhorter et al., 2003
cell Cajal body ab1-tmg labeling decreased amount, abnormal AB + MO1-smn1 standard conditions Fig. 8 from Strzelecka et al., 2010
cell small nuclear ribonucleoprotein complex dispersed, abnormal AB + MO1-smn1 standard conditions Fig. 8 from Strzelecka et al., 2010
CaP motoneuron axon decreased length, abnormal AB + MO1-smn1 standard conditions Fig. 1 from McWhorter et al., 2003
motor neuron axon increased branchiness, abnormal AB + MO1-smn1 standard conditions Table S9 from Van Hoecke et al., 2012
cell Cajal body ab1-coil labeling decreased amount, abnormal AB + MO1-smn1 standard conditions Fig. 8 from Strzelecka et al., 2010
whole organism smn1 expression decreased amount, abnormal AB + MO1-smn1 standard conditions Fig. 1 from Powis et al., 2016
CaP motoneuron morphology, abnormal AB + MO1-smn1 standard conditions Fig. 4 from McWhorter et al., 2008
cell Cajal body decreased amount, abnormal AB + MO1-smn1 standard conditions Fig. 8 from Strzelecka et al., 2010
whole organism Ab3-ub labeling decreased amount, abnormal AB + MO1-smn1 standard conditions Fig. 1 from Powis et al., 2016
CaP motoneuron axon increased branchiness, abnormal AB + MO1-smn1 standard conditions Fig. 1 from McWhorter et al., 2003
motor neuron axon truncated, abnormal WT + MO1-smn1 standard conditions Fig. 5 from Winkler et al., 2005
ATP biosynthetic process decreased efficacy, abnormal WT + MO1-smn1 standard conditions Fig. 2 from Boyd et al., 2017
primary motor neuron axon decreased length, abnormal WT + MO1-smn1 standard conditions Fig. 5 with image from Boyd et al., 2017
motor neuron axon morphology, abnormal WT + MO1-smn1 standard conditions Fig. 4 from Oprea et al., 2008
whole organism aerobic respiration decreased efficacy, abnormal WT + MO1-smn1 standard conditions Fig. 2 from Boyd et al., 2017
motor neuron axon branchiness, abnormal WT + MO1-smn1 standard conditions Fig. 5 from Winkler et al., 2005
whole organism Ab2-atp5a labeling decreased amount, abnormal WT + MO1-smn1 standard conditions Fig. 2 from Boyd et al., 2017
CaP motoneuron axon decreased length, abnormal WT + MO1-smn1 standard conditions Fig. 7 with image from Chitramuthu et al., 2010
primary motor neuron axon terminus swollen, abnormal WT + MO1-smn1 standard conditions Fig. 5 with image from Boyd et al., 2017
axon extension process quality, abnormal WT + MO1-smn1 standard conditions Fig. 7 with image from Chitramuthu et al., 2010
whole organism mitochondrion decreased functionality, abnormal WT + MO1-smn1 standard conditions Fig. 2 from Boyd et al., 2017
mRNA splicing, via spliceosome decreased process quality, abnormal WT + MO1-smn1 standard conditions Fig. 2 from See et al., 2014
CaP motoneuron axon branched, abnormal WT + MO1-smn1 standard conditions Fig. 4 from See et al., 2014
Fig. 7 with image from Chitramuthu et al., 2010
axonogenesis disrupted, abnormal WT + MO1-smn1 standard conditions Fig. 4 from Oprea et al., 2008
CaP motoneuron axon truncated, abnormal WT + MO1-smn1 standard conditions Fig. 4 from See et al., 2014
primary motor neuron axonogenesis disrupted, abnormal WT + MO1-smn1 standard conditions Fig. 5 with image from Boyd et al., 2017
fast muscle cell synaptic cleft decreased width, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 3 from Riessland et al., 2017
CaP motoneuron axon decreased length, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 3 from Riessland et al., 2017
motor neuron axon morphology, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 1 from Powis et al., 2016
CaP motoneuron axon increased branchiness, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 3 from Riessland et al., 2017
axonogenesis disrupted, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 5 from Sleigh et al., 2014
motor neuron axon guidance disrupted, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 5 from Sleigh et al., 2014
primary motor neuron axon decreased length, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 3 with imageFig. 6 with image from Boyd et al., 2017
swimming decreased rate, abnormal ml2Tg + MO1-smn1 standard conditions Fig. S3 from Riessland et al., 2017
primary motor neuron axonogenesis disrupted, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 3 with imageFig. 6 with image from Boyd et al., 2017
CaP motoneuron axon extension involved in axon guidance decreased process quality, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 3 from Riessland et al., 2017
motor neuron axon increased branchiness, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 8 from Hosseinibarkooie et al., 2016
motor neuron decreased amount, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 5 from Sleigh et al., 2014
motor neuron axon bifurcated, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 5 from Sleigh et al., 2014
primary motor neuron axon terminus swollen, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 6 with image from Boyd et al., 2017
primary motor neuron axon length, ameliorated ml2Tg + MO1-smn1 chemical treatment: terazosin Fig. 6 with image from Boyd et al., 2017
fast muscle cell neuromuscular synaptic transmission decreased process quality, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 3 from Riessland et al., 2017
motor neuron axon branchiness, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 1 from Powis et al., 2016
motor neuron axon absent, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 5 from Sleigh et al., 2014
whole organism smn1 expression decreased amount, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 3 from Riessland et al., 2017
swimming behavior process quality, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 1 from Powis et al., 2016
fast muscle cell neuromuscular junction decreased width, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 3 from Riessland et al., 2017
primary motor neuron axonogenesis process efficacy, ameliorated ml2Tg + MO1-smn1 chemical treatment: terazosin Fig. 6 with image from Boyd et al., 2017
fast muscle cell neuromuscular junction development decreased process quality, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 3 from Riessland et al., 2017
CaP motoneuron collateral sprouting increased occurrence, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 3 from Riessland et al., 2017
motor neuron axon truncated, abnormal ml2Tg + MO1-smn1 standard conditions Fig. 8 from Hosseinibarkooie et al., 2016
Fig. 1 from Powis et al., 2016
Fig. 5 from Sleigh et al., 2014
motor neuron axon truncated, abnormal ml2Tg + MO1-smn1 (EKW, TL) standard conditions Fig. 6 from Wishart et al., 2014
motor neuron axon branchiness, abnormal ml2Tg + MO1-smn1 (EKW, TL) standard conditions Fig. 6 from Wishart et al., 2014
motor neuron axon increased branchiness, abnormal ml2Tg + MO1-smn1 + MO2-smn1 standard conditions Fig. 4 with image from Akten et al., 2011
motor neuron axon truncated, abnormal ml2Tg + MO1-smn1 + MO2-smn1 standard conditions Fig. 4 with image from Akten et al., 2011
motor neuron axon morphology, abnormal ml2Tg + MO1-smn1 + MO2-smn1 standard conditions Fig. 4 with image from Akten et al., 2011
motor neuron axon mislocalised, abnormal os26Tg + MO1-smn1 standard conditions Fig. 6 with image from Lotti et al., 2012
motor neuron axon truncated, abnormal os26Tg + MO1-smn1 standard conditions Fig. 1 from Lyon et al., 2014
motor neuron axon extension disrupted, abnormal os26Tg + MO1-smn1 standard conditions Fig. 2 with image from McGovern et al., 2015
motor neuron axon guidance decreased process quality, abnormal os26Tg + MO1-smn1 standard conditions Fig. 6 with image from Lotti et al., 2012
motor neuron axon morphology, abnormal os26Tg + MO1-smn1 standard conditions Fig. 2 with image from McGovern et al., 2015
Fig. 5 from Wiley et al., 2014
motor neuron axon branched, abnormal os26Tg + MO1-smn1 standard conditions Fig. 1 from Lyon et al., 2014
motor neuron axon truncated, abnormal rw0Tg + MO1-smn1 standard conditions Fig. 4 from McWhorter et al., 2003
motor neuron axon increased branchiness, abnormal rw0Tg + MO1-smn1 standard conditions Fig. 4 from McWhorter et al., 2003
motor neuron axon branchiness, abnormal vu12Tg + MO1-smn1 standard conditions Fig. 5 from Miller et al., 2015
motor neuron axon truncated, abnormal vu12Tg + MO1-smn1 standard conditions Fig. 5 from Miller et al., 2015
motor neuron axon increased branchiness, abnormal vu12Tg + MO1-smn1 standard conditions Fig. 2 from Edens et al., 2015
motor neuron axon decreased length, abnormal vu12Tg + MO1-smn1 standard conditions Fig. 2 from Edens et al., 2015
motor neuron axon extension process quality, abnormal vu12Tg + MO1-smn1 standard conditions Fig. 2 from Edens et al., 2015
motor neuron axon morphology, abnormal vu12Tg + MO1-smn1 standard conditions Fig. 5 from Miller et al., 2015
motor neuron axon truncated, abnormal zf35Tg + MO1-smn1 standard conditions Fig. 3 from McWhorter et al., 2003
motor neuron axon branched, abnormal zf35Tg + MO1-smn1 standard conditions Fig. 3 from McWhorter et al., 2003
neuron protein transport decreased rate, abnormal ns12Tg/ns12Tg + MO1-smn1 standard conditions FIGURE 3 with image from Koh et al., 2021
neuron regulation of protein oligomerization decreased rate, abnormal ns12Tg/ns12Tg + MO1-smn1 standard conditions FIGURE 3 with image from Koh et al., 2021
whole organism lethal (sensu genetics), abnormal WT + MO1-pls3 + MO1-smn1 standard conditions text only from Oprea et al., 2008
whole organism ncaldb expression absent, abnormal ml2Tg + MO1-ncaldb + MO1-smn1 standard conditions Fig. 3 from Riessland et al., 2017
CaP motoneuron axon length, ameliorated ml2Tg + MO1-ncaldb + MO1-smn1 standard conditions Fig. 3 from Riessland et al., 2017
CaP motoneuron axon extension involved in axon guidance process quality, ameliorated ml2Tg + MO1-ncaldb + MO1-smn1 standard conditions Fig. 3 from Riessland et al., 2017
fast muscle cell neuromuscular synaptic transmission process quality, ameliorated ml2Tg + MO1-ncaldb + MO1-smn1 standard conditions Fig. 3 from Riessland et al., 2017
whole organism smn1 expression decreased amount, abnormal ml2Tg + MO1-ncaldb + MO1-smn1 standard conditions Fig. 3 from Riessland et al., 2017
swimming rate, ameliorated ml2Tg + MO1-ncaldb + MO1-smn1 standard conditions Fig. S3 from Riessland et al., 2017
CaP motoneuron axon increased branchiness, abnormal ml2Tg + MO1-ncaldb + MO1-smn1 standard conditions Fig. 3 from Riessland et al., 2017
fast muscle cell synaptic cleft width, ameliorated ml2Tg + MO1-ncaldb + MO1-smn1 standard conditions Fig. 3 from Riessland et al., 2017
fast muscle cell neuromuscular junction width, ameliorated ml2Tg + MO1-ncaldb + MO1-smn1 standard conditions Fig. 3 from Riessland et al., 2017
CaP motoneuron collateral sprouting increased occurrence, abnormal ml2Tg + MO1-ncaldb + MO1-smn1 standard conditions Fig. 3 from Riessland et al., 2017
fast muscle cell neuromuscular junction development process quality, ameliorated ml2Tg + MO1-ncaldb + MO1-smn1 standard conditions Fig. 3 from Riessland et al., 2017
Citations