Morpholino

MO1-acvr2ba

ID

ZDB-MRPHLNO-050811-2

Name

MO1-acvr2ba

Previous Names

MO1-acvr2b

Target

acvr2ba (1)

Sequence

5' - GCAGAGAAGCGAACATATTCCTTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-acvr2ba

Expressed Gene	Anatomy	Figures
dlx2a	mandibular arch skeleton neural crest pharyngeal arch 2 skeleton pharyngeal arch 3 skeleton pharyngeal arch 4 skeleton	Fig. 5 from Albertson et al., 2005
egr2b	(not) cranial neural crest rhombomere 3 rhombomere 5	Fig. 5 from Albertson et al., 2005
pax2a	midbrain hindbrain boundary neural rod optic vesicle otic placode primary neuron pronephric duct	Fig. 5 from Albertson et al., 2005

Phenotype

Phenotype resulting from MO1-acvr2ba

Phenotype	Fish	Figures
branchiostegal ray 1 aplastic, abnormal	WT + MO1-acvr2ba	Fig. 4 from Albertson et al., 2005
branchiostegal ray 3 decreased size, abnormal	WT + MO1-acvr2ba	Fig. 4 from Albertson et al., 2005
branchiostegal ray 3 shape, abnormal	WT + MO1-acvr2ba	Fig. 4 from Albertson et al., 2005
ceratobranchial 5 cartilage truncated, abnormal	WT + MO1-acvr2ba	Fig. 4 from Albertson et al., 2005
ceratobranchial 5 tooth decreased amount, abnormal	WT + MO1-acvr2ba	Fig. 4 from Albertson et al., 2005
ceratobranchial 5 tooth malformed, abnormal	WT + MO1-acvr2ba	Fig. 4 from Albertson et al., 2005
ceratobranchial cartilage decreased size, abnormal	WT + MO1-acvr2ba	Fig. 4 from Albertson et al., 2005
dentary decreased size, abnormal	WT + MO1-acvr2ba	Fig. 4 from Albertson et al., 2005
dentary shape, abnormal	WT + MO1-acvr2ba	Fig. 4 from Albertson et al., 2005
endochondral bone aplastic, abnormal	WT + MO1-acvr2ba	Fig. 4 from Albertson et al., 2005
eye mislocalised laterally, abnormal	WT + MO1-acvr2ba	Fig. 4 from Albertson et al., 2005
eye swollen, abnormal	WT + MO1-acvr2ba	Fig. 4 from Albertson et al., 2005
hindbrain apoptotic, abnormal	WT + MO1-acvr2ba	Fig. 6 from Albertson et al., 2005
maxilla decreased size, abnormal	WT + MO1-acvr2ba	Fig. 4 from Albertson et al., 2005
maxilla fused with maxilla, abnormal	WT + MO1-acvr2ba	Fig. 4 from Albertson et al., 2005
maxilla shape, abnormal	WT + MO1-acvr2ba	Fig. 4 from Albertson et al., 2005
midbrain apoptotic, abnormal	WT + MO1-acvr2ba	Fig. 6 from Albertson et al., 2005
opercle decreased size, abnormal	WT + MO1-acvr2ba	Fig. 4 from Albertson et al., 2005
opercle shape, abnormal	WT + MO1-acvr2ba	Fig. 4 from Albertson et al., 2005
pharyngeal arch mislocalised laterally, abnormal	WT + MO1-acvr2ba	Fig. 4 from Albertson et al., 2005
whole organism decreased length, abnormal	WT + MO1-acvr2ba	Fig. 4 from Albertson et al., 2005

Phenotype of all Fish created by or utilizing MO1-acvr2ba

Phenotype	Fish	Conditions	Figures
maxilla decreased size, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 4 from Albertson et al., 2005
ceratobranchial 5 tooth decreased amount, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 4 from Albertson et al., 2005
dentary decreased size, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 4 from Albertson et al., 2005
opercle decreased size, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 4 from Albertson et al., 2005
pharyngeal arch mislocalised laterally, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 4 from Albertson et al., 2005
branchiostegal ray 3 shape, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 4 from Albertson et al., 2005
maxilla shape, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 4 from Albertson et al., 2005
ceratobranchial 5 tooth malformed, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 4 from Albertson et al., 2005
hindbrain apoptotic, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 6 from Albertson et al., 2005
dentary shape, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 4 from Albertson et al., 2005
ceratobranchial cartilage decreased size, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 4 from Albertson et al., 2005
ceratobranchial 5 cartilage truncated, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 4 from Albertson et al., 2005
branchiostegal ray 1 aplastic, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 4 from Albertson et al., 2005
endochondral bone aplastic, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 4 from Albertson et al., 2005
opercle shape, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 4 from Albertson et al., 2005
eye swollen, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 4 from Albertson et al., 2005
whole organism decreased length, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 4 from Albertson et al., 2005
eye mislocalised laterally, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 4 from Albertson et al., 2005
midbrain apoptotic, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 6 from Albertson et al., 2005
maxilla fused with maxilla, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 4 from Albertson et al., 2005
branchiostegal ray 3 decreased size, abnormal	WT + MO1-acvr2ba	standard conditions	Fig. 4 from Albertson et al., 2005

Citations