Morpholino

MO2-fn1b

ID
ZDB-MRPHLNO-050620-4
Name
MO2-fn1b
Previous Names
  • MO2 fn3 (1)
Target
Sequence
5' - GCTTCTGGCTTTGACTGTATTTCGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-fn1b
No data available
Phenotype
Phenotype resulting from MO2-fn1b
No data available
Phenotype of all Fish created by or utilizing MO2-fn1b
Phenotype Fish Conditions Figures
myotome myosin filament disorganized, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 2 with imageFig. 3 with imageFig. 4 with image from Snow et al., 2008
myotome muscle tendon junction morphology, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 2 with image from Snow et al., 2008
somite shape, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with image from Snow et al., 2008
myotome actin filament increased length, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 2 with imageFig. 3 with image from Snow et al., 2008
myotome variant shape, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with imageFig. 2 with image from Snow et al., 2008
somite border aplastic, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with image from Snow et al., 2008
skeletal muscle fiber development disrupted, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 2 with imageFig. 3 with image from Snow et al., 2008
somitogenesis disrupted, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with image from Snow et al., 2008
myotome actin filament disorganized, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 4 with image from Snow et al., 2008
somite border shape, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with imageFig. 2 with image from Snow et al., 2008
myotome increased size, abnormal WT + MO1-fn1a + MO1-fn1b + MO2-fn1b standard conditions Fig. 1 with image from Snow et al., 2008
intersegmental vessel branching involved in blood vessel morphogenesis decreased process quality, ameliorated tardbpamde159/mde159; tardbpbmde198/mde198; y1Tg/y1Tg + MO1-fn1b + MO2-fn1b standard conditions FIGURE 6 with image from Hipke et al., 2023
intersegmental vessel EGFP expression spatial pattern, ameliorated tardbpamde159/mde159; tardbpbmde198/mde198; y1Tg/y1Tg + MO1-fn1b + MO2-fn1b standard conditions FIGURE 6 with image from Hipke et al., 2023
intersegmental vessel EGFP expression spatial pattern, ameliorated tardbpamde222/mde222; tardbpbmde198/mde198; y1Tg/y1Tg + MO1-fn1b + MO2-fn1b standard conditions FIGURE 6 with image from Hipke et al., 2023
intersegmental vessel branching involved in blood vessel morphogenesis decreased process quality, ameliorated tardbpamde222/mde222; tardbpbmde198/mde198; y1Tg/y1Tg + MO1-fn1b + MO2-fn1b standard conditions FIGURE 6 with image from Hipke et al., 2023
Citations