Morpholino
MO1-fn1b
- ID
- ZDB-MRPHLNO-050620-3
- Name
- MO1-fn1b
- Previous Names
-
- MO1 fn3 (1)
- Target
- Sequence
-
5' - TACTGACTCACGGGTCATTTTCACC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-fn1b
No data available
Phenotype
Phenotype resulting from MO1-fn1b
No data available
Phenotype of all Fish created by or utilizing MO1-fn1b
1 - 5 of 18 Show all
Citations
- Hipke, K., Pitter, B., Hruscha, A., van Bebber, F., Modic, M., Bansal, V., Lewandowski, S.A., Orozco, D., Edbauer, D., Bonn, S., Haass, C., Pohl, U., Montanez, E., Schmid, B. (2023) Loss of TDP-43 causes ectopic endothelial sprouting and migration defects through increased fibronectin, vcam 1 and integrin α4/β1. Frontiers in cell and developmental biology. 11:11699621169962
- Prince, D.J., Jessen, J.R. (2019) Dorsal convergence of gastrula cells requires a Vangl2 and adhesion protein-dependent change in protrusive activity. Development (Cambridge, England). 146(22):
- Rho, S.S., Kobayashi, I., Oguri-Nakamura, E., Ando, K., Fujiwara, M., Kamimura, N., Hirata, H., Iida, A., Iwai, Y., Mochizuki, N., Fukuhara, S. (2019) Rap1b Promotes Notch-Signal-Mediated Hematopoietic Stem Cell Development by Enhancing Integrin-Mediated Cell Adhesion. Developmental Cell. 49(5):681-696.e6
- Love, A.M., Prince, D.J., Jessen, J.R. (2018) Vangl2-dependent regulation of membrane protrusions and directed migration requires a fibronectin extracellular matrix. Development (Cambridge, England). 145(22):
- Cheng, P., Andersen, P., Hassel, D., Kaynak, B.L., Limphong, P., Juergensen, L., Kwon, C., and Srivastava, D. (2013) Fibronectin mediates mesendodermal cell fate decisions. Development (Cambridge, England). 140(12):2587-2596
- Chiu, C.H., Chou, C.W., Takada, S., and Liu, Y.W. (2012) Development and fibronectin signaling requirements of the zebrafish interrenal vessel. PLoS One. 7(8):e43040
- Latimer, A., and Jessen, J.R. (2010) Extracellular matrix assembly and organization during zebrafish gastrulation. Matrix biology : journal of the International Society for Matrix Biology. 29(2):89-96
- Snow, C.J., Peterson, M.T., Khalil, A., and Henry, C.A. (2008) Muscle development is disrupted in zebrafish embryos deficient for fibronectin. Developmental Dynamics : an official publication of the American Association of Anatomists. 237(9):2542-2553
- Jülich, D., Geisler, R., Tübingen 2000 Screen Consortium, and Holley, S.A. (2005) Integrinalpha5 and Delta/Notch Signaling Have Complementary Spatiotemporal Requirements during Zebrafish Somitogenesis. Developmental Cell. 8(4):575-586
1 - 9 of 9
Show