Morpholino

MO1-mxtx2

ID

ZDB-MRPHLNO-050607-3

Name

MO1-mxtx2

Previous Names

mtx2 MO (1)
Mtx2-MO1 (1)

Target

mxtx2 (1)

Sequence

5' - CATTGAGTATTTTGCAGCTCTCTTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-mxtx2

No data available

Phenotype

Phenotype resulting from MO1-mxtx2

Phenotype	Fish	Figures
blastoderm increased thickness, abnormal	ha01Tg + MO1-mxtx2	Fig. S3 from Wilkins et al., 2008
blastoderm irregular spatial pattern, abnormal	ha01Tg + MO1-mxtx2	Fig. S3 from Wilkins et al., 2008
blastoderm morphology, abnormal	WT + MO1-mxtx2	Fig. 1 from Wilkins et al., 2008
cell migration involved in gastrulation disrupted, abnormal	ha01Tg + MO1-mxtx2	Fig. 6 from Wilkins et al., 2008
epiboly involved in gastrulation with mouth forming second disrupted, abnormal	WT + MO1-mxtx2	Fig. 1 , Fig. 3 from Wilkins et al., 2008
external yolk syncytial layer filamentous actin disorganized, abnormal	WT + MO1-mxtx2	Fig. 4 from Wilkins et al., 2008
external yolk syncytial layer microvillus decreased length, abnormal	WT + MO1-mxtx2	Fig. 3 from Wilkins et al., 2008
external yolk syncytial layer microvillus decreased mass density, abnormal	WT + MO1-mxtx2	Fig. 3 from Wilkins et al., 2008
gastrulation disrupted, abnormal	TU + MO1-mxtx2	Fig. 4 from Xu et al., 2012
margin constricted, abnormal	TU + MO1-mxtx2	Fig. 4 from Xu et al., 2012
margin irregular spatial pattern, abnormal	WT + MO1-mxtx2	Fig. 5 from Wilkins et al., 2008
margin morphology, abnormal	WT + MO1-mxtx2	Fig. 1 from Wilkins et al., 2008
mesendoderm development disrupted, abnormal	ha01Tg + MO1-mxtx2	Fig. 6 from Wilkins et al., 2008
shield morphology, abnormal	WT + MO1-mxtx2	Fig. 5 from Wilkins et al., 2008
whole organism lacks parts or has fewer parts of type presumptive endoderm, abnormal	TU + MO1-mxtx2	Fig. 4 from Xu et al., 2012
yolk broken, abnormal	TU + MO1-mxtx2	Fig. 4 from Xu et al., 2012
yolk syncytial layer disorganized, abnormal	WT + MO1-mxtx2	Fig. 2 from Wilkins et al., 2008

Phenotype of all Fish created by or utilizing MO1-mxtx2

Phenotype	Fish	Conditions	Figures
gastrulation disrupted, abnormal	TU + MO1-mxtx2	standard conditions	Fig. 4 from Xu et al., 2012
whole organism lacks parts or has fewer parts of type presumptive endoderm, abnormal	TU + MO1-mxtx2	standard conditions	Fig. 4 from Xu et al., 2012
margin constricted, abnormal	TU + MO1-mxtx2	standard conditions	Fig. 4 from Xu et al., 2012
yolk broken, abnormal	TU + MO1-mxtx2	standard conditions	Fig. 4 from Xu et al., 2012
yolk syncytial layer disorganized, abnormal	WT + MO1-mxtx2	standard conditions	Fig. 2 from Wilkins et al., 2008
blastoderm morphology, abnormal	WT + MO1-mxtx2	standard conditions	Fig. 1 from Wilkins et al., 2008
external yolk syncytial layer microvillus decreased length, abnormal	WT + MO1-mxtx2	standard conditions	Fig. 3 from Wilkins et al., 2008
epiboly involved in gastrulation with mouth forming second disrupted, abnormal	WT + MO1-mxtx2	standard conditions	Fig. 1 , Fig. 3 from Wilkins et al., 2008
margin irregular spatial pattern, abnormal	WT + MO1-mxtx2	standard conditions	Fig. 5 from Wilkins et al., 2008
external yolk syncytial layer filamentous actin disorganized, abnormal	WT + MO1-mxtx2	standard conditions	Fig. 4 from Wilkins et al., 2008
external yolk syncytial layer microvillus decreased mass density, abnormal	WT + MO1-mxtx2	standard conditions	Fig. 3 from Wilkins et al., 2008
margin morphology, abnormal	WT + MO1-mxtx2	standard conditions	Fig. 1 from Wilkins et al., 2008
shield morphology, abnormal	WT + MO1-mxtx2	standard conditions	Fig. 5 from Wilkins et al., 2008
cell migration involved in gastrulation disrupted, abnormal	ha01Tg + MO1-mxtx2	standard conditions	Fig. 6 from Wilkins et al., 2008
blastoderm increased thickness, abnormal	ha01Tg + MO1-mxtx2	standard conditions	Fig. S3 from Wilkins et al., 2008
mesendoderm development disrupted, abnormal	ha01Tg + MO1-mxtx2	standard conditions	Fig. 6 from Wilkins et al., 2008
blastoderm irregular spatial pattern, abnormal	ha01Tg + MO1-mxtx2	standard conditions	Fig. S3 from Wilkins et al., 2008

Citations