Morpholino

MO1-mxtx2

ID
ZDB-MRPHLNO-050607-3
Name
MO1-mxtx2
Previous Names
  • mtx2 MO (1)
  • Mtx2-MO1 (1)
Target
Sequence
5' - CATTGAGTATTTTGCAGCTCTCTTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mxtx2
Phenotype
Phenotype resulting from MO1-mxtx2
Phenotype Fish Figures
blastoderm increased thickness, abnormal ha01Tg + MO1-mxtx2 Fig. S3 with image from Wilkins et al., 2008
blastoderm irregular spatial pattern, abnormal ha01Tg + MO1-mxtx2 Fig. S3 with image from Wilkins et al., 2008
blastoderm morphology, abnormal WT + MO1-mxtx2 Fig. 1 with image from Wilkins et al., 2008
cell migration involved in gastrulation disrupted, abnormal ha01Tg + MO1-mxtx2 Fig. 6 with image from Wilkins et al., 2008
epiboly involved in gastrulation with mouth forming second disrupted, abnormal WT + MO1-mxtx2 Fig. 1 with imageFig. 3 with image from Wilkins et al., 2008
external yolk syncytial layer filamentous actin disorganized, abnormal WT + MO1-mxtx2 Fig. 4 with image from Wilkins et al., 2008
external yolk syncytial layer microvillus decreased length, abnormal WT + MO1-mxtx2 Fig. 3 with image from Wilkins et al., 2008
external yolk syncytial layer microvillus decreased mass density, abnormal WT + MO1-mxtx2 Fig. 3 with image from Wilkins et al., 2008
gastrulation disrupted, abnormal TU + MO1-mxtx2 Fig. 4 with image from Xu et al., 2012
margin constricted, abnormal TU + MO1-mxtx2 Fig. 4 with image from Xu et al., 2012
margin irregular spatial pattern, abnormal WT + MO1-mxtx2 Fig. 5 with image from Wilkins et al., 2008
margin morphology, abnormal WT + MO1-mxtx2 Fig. 1 with image from Wilkins et al., 2008
mesendoderm development disrupted, abnormal ha01Tg + MO1-mxtx2 Fig. 6 with image from Wilkins et al., 2008
shield morphology, abnormal WT + MO1-mxtx2 Fig. 5 with image from Wilkins et al., 2008
whole organism lacks parts or has fewer parts of type presumptive endoderm, abnormal TU + MO1-mxtx2 Fig. 4 with image from Xu et al., 2012
yolk broken, abnormal TU + MO1-mxtx2 Fig. 4 with image from Xu et al., 2012
yolk syncytial layer disorganized, abnormal WT + MO1-mxtx2 Fig. 2 with image from Wilkins et al., 2008
Phenotype of all Fish created by or utilizing MO1-mxtx2
Phenotype Fish Conditions Figures
gastrulation disrupted, abnormal TU + MO1-mxtx2 standard conditions Fig. 4 with image from Xu et al., 2012
whole organism lacks parts or has fewer parts of type presumptive endoderm, abnormal TU + MO1-mxtx2 standard conditions Fig. 4 with image from Xu et al., 2012
margin constricted, abnormal TU + MO1-mxtx2 standard conditions Fig. 4 with image from Xu et al., 2012
yolk broken, abnormal TU + MO1-mxtx2 standard conditions Fig. 4 with image from Xu et al., 2012
blastoderm morphology, abnormal WT + MO1-mxtx2 standard conditions Fig. 1 with image from Wilkins et al., 2008
yolk syncytial layer disorganized, abnormal WT + MO1-mxtx2 standard conditions Fig. 2 with image from Wilkins et al., 2008
external yolk syncytial layer microvillus decreased length, abnormal WT + MO1-mxtx2 standard conditions Fig. 3 with image from Wilkins et al., 2008
epiboly involved in gastrulation with mouth forming second disrupted, abnormal WT + MO1-mxtx2 standard conditions Fig. 1 with imageFig. 3 with image from Wilkins et al., 2008
margin irregular spatial pattern, abnormal WT + MO1-mxtx2 standard conditions Fig. 5 with image from Wilkins et al., 2008
external yolk syncytial layer microvillus decreased mass density, abnormal WT + MO1-mxtx2 standard conditions Fig. 3 with image from Wilkins et al., 2008
external yolk syncytial layer filamentous actin disorganized, abnormal WT + MO1-mxtx2 standard conditions Fig. 4 with image from Wilkins et al., 2008
margin morphology, abnormal WT + MO1-mxtx2 standard conditions Fig. 1 with image from Wilkins et al., 2008
shield morphology, abnormal WT + MO1-mxtx2 standard conditions Fig. 5 with image from Wilkins et al., 2008
cell migration involved in gastrulation disrupted, abnormal ha01Tg + MO1-mxtx2 standard conditions Fig. 6 with image from Wilkins et al., 2008
blastoderm increased thickness, abnormal ha01Tg + MO1-mxtx2 standard conditions Fig. S3 with image from Wilkins et al., 2008
mesendoderm development disrupted, abnormal ha01Tg + MO1-mxtx2 standard conditions Fig. 6 with image from Wilkins et al., 2008
blastoderm irregular spatial pattern, abnormal ha01Tg + MO1-mxtx2 standard conditions Fig. S3 with image from Wilkins et al., 2008
Citations