Morpholino

MO1-nfe2l2a

ID
ZDB-MRPHLNO-050603-1
Name
MO1-nfe2l2a
Previous Names
  • MO1-nfe2l2
Target
Sequence
5' - CATTTCAATCTCCATCATGTCTCAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Morpholino sequence provided by authors.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nfe2l2a
Expressed Gene Anatomy Figures
abcc2 Fig. 1 with image from Nakajima et al., 2011
atf3 Fig. 6 from Timme-Laragy et al., 2012
bcat1 Fig. 1 with image,  Fig. 2 with image from Nakajima et al., 2011
blvra Fig. 3,  Fig. 5 from Holowiecki et al., 2017
blvrb Fig. 3,  Fig. 5 from Holowiecki et al., 2017
ccng1 Fig. 8 from Timme-Laragy et al., 2012
chmp2a Fig. 1 with image from Nakajima et al., 2011
cpa5 Fig. 4 with image from Zhang et al., 2014
ctrb.1 Fig. S2 with image from Zhang et al., 2014
ctrl Fig. S2 with image from Zhang et al., 2014
ela2l Fig. S2 with image from Zhang et al., 2014
gclc Fig. 1 with image,  Fig. 2 with image from Nakajima et al., 2011
gclm Fig. 1 with image,  Fig. 2 with image from Nakajima et al., 2011
gja13.1 Fig. 1 with image from Nakajima et al., 2011
gsta.1 Fig. 1 with image,  Fig. 2 with image from Nakajima et al., 2011
gstp1.1 Fig. 2 from Suzuki et al., 2005
gstp1.2 Fig. 1 with image,  Fig. 3 with image,  Fig. S9 with image from Mukaigasa et al., 2018
Fig. 2 from Onyiah et al., 2013
Fig. 6 from Timme-Laragy et al., 2012
Fig. 1 with image,  Fig. 2 with image from Nakajima et al., 2011
Fig. 1 from Kobayashi et al., 2009
Fig. 2 from Suzuki et al., 2005
hmox1a Fig. 1 with image from Mukaigasa et al., 2018
Fig. 4,  Fig. 5 from Holowiecki et al., 2017
Fig. 2 from Onyiah et al., 2013
Fig. 8 from Timme-Laragy et al., 2012
Fig. 1 with image,  Fig. 2 with image from Nakajima et al., 2011
hsp70l Fig. 6 from Timme-Laragy et al., 2012
mgst3b Fig. 1 with image,  Fig. 2 with image from Nakajima et al., 2011
mitfa Fig. 6 from Timme-Laragy et al., 2012
prdx1 Fig. 1 with image,  Fig. 2 with image from Nakajima et al., 2011
prss1 Fig. S2 with image from Zhang et al., 2014
prss59.1 Fig. S2 with image from Zhang et al., 2014
selenow2b Fig. 1 with image,  Fig. 2 with image from Nakajima et al., 2011
tcnbb Fig. 1 with image from Nakajima et al., 2011
tp53 Fig. 8 from Timme-Laragy et al., 2012
txnrd3 Fig. 1 with image from Nakajima et al., 2011
ugdh Fig. 1 with image from Nakajima et al., 2011
fthl27 Fig. 1 with image,  Fig. 2 with image from Nakajima et al., 2011
zgc:163022 Fig. 1 with image,  Fig. 2 with image from Nakajima et al., 2011
Phenotype
Phenotype resulting from MO1-nfe2l2a
Phenotype Fish Figures
anatomical structure glutathione decreased amount, abnormal TL + MO1-nfe2l2a Fig. 4 from Sant et al., 2017
anatomical structure glutathione disulfide increased amount, abnormal TL + MO1-nfe2l2a Fig. 4,  Fig. 6 from Sant et al., 2017
caudal hematopoietic tissue blvrb expression increased amount, abnormal TL + MO1-nfe2l2a Fig. 5 from Holowiecki et al., 2017
glutathione disulfide oxidoreductase activity increased occurrence, abnormal TL + MO1-nfe2l2a Fig. 4,  Fig. 6 from Sant et al., 2017
whole organism EGFP expression decreased amount, abnormal it416bTg + MO1-nfe2l2a Fig. S8 from Poganik et al., 2019
whole organism hmox1a expression decreased amount, abnormal TL + MO1-nfe2l2a Fig. 4 from Holowiecki et al., 2017
Phenotype of all Fish created by or utilizing MO1-nfe2l2a
Phenotype Fish Conditions Figures
gill gstp1.2 expression amount, ameliorated AB + MO1-nfe2l2a chemical treatment: tunicamycin Fig. 3 with image from Mukaigasa et al., 2018
gill gstp1.2 expression amount, ameliorated AB + MO1-nfe2l2a chemical treatment: thapsigargin Fig. 3 with image from Mukaigasa et al., 2018
caudal hematopoietic tissue blvrb expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: elemental cadmium Fig. 5 from Holowiecki et al., 2017
whole organism blvrb expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: cadmium dichloride Fig. 8 from Holowiecki et al., 2016
liver hmox1a expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: elemental cadmium Fig. 5 from Holowiecki et al., 2017
caudal hematopoietic tissue blvrb expression increased amount, abnormal TL + MO1-nfe2l2a control Fig. 5 from Holowiecki et al., 2017
whole organism hmox1b expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: cadmium dichloride Fig. 8 from Holowiecki et al., 2016
anatomical structure glutathione disulfide increased amount, abnormal TL + MO1-nfe2l2a chemical treatment by environment: tert-butyl hydroperoxide Fig. 6 from Sant et al., 2017
anatomical structure glutathione decreased amount, abnormal TL + MO1-nfe2l2a standard conditions Fig. 4 from Sant et al., 2017
heart blvrb expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: elemental cadmium Fig. 5 from Holowiecki et al., 2017
anatomical structure glutathione disulfide increased amount, abnormal TL + MO1-nfe2l2a control Fig. 4,  Fig. 6 from Sant et al., 2017
whole organism hmox1a expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: cadmium dichloride Fig. 8 from Holowiecki et al., 2016
glutathione disulfide oxidoreductase activity increased occurrence, abnormal TL + MO1-nfe2l2a control Fig. 4,  Fig. 6 from Sant et al., 2017
glutathione disulfide oxidoreductase activity increased occurrence, exacerbated TL + MO1-nfe2l2a chemical treatment by environment: tert-butyl hydroperoxide Fig. 6 from Sant et al., 2017
whole organism hmox1a expression decreased amount, abnormal TL + MO1-nfe2l2a standard conditions Fig. 4 from Holowiecki et al., 2017
liver blvrb expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: elemental cadmium Fig. 5 from Holowiecki et al., 2017
whole organism decreased life span, abnormal WT + MO1-nfe2l2a chemical treatment: pharmaceutical Fig. 4 with image from Cox et al., 2014
whole organism EGFP expression decreased amount, abnormal it416bTg + MO1-nfe2l2a control Fig. S8 from Poganik et al., 2019
liver hmox1a expression amount, ameliorated pmm2it768/it768 + MO1-nfe2l2a standard conditions Fig. 1 with image from Mukaigasa et al., 2018
gill gstp1.2 expression increased amount, abnormal pmm2it768/it768 + MO1-nfe2l2a standard conditions Fig. S9 with image from Mukaigasa et al., 2018
gill gstp1.2 expression amount, ameliorated pmm2it768/it768 + MO1-nfe2l2a standard conditions Fig. 1 with image from Mukaigasa et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.