Morpholino

MO1-nfe2l2a

ID
ZDB-MRPHLNO-050603-1
Name
MO1-nfe2l2a
Previous Names
  • MO1-nfe2l2
Target
Sequence
5' - CATTTCAATCTCCATCATGTCTCAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Morpholino sequence provided by authors.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nfe2l2a
No data available
Phenotype
Phenotype resulting from MO1-nfe2l2a
Phenotype Fish Figures
anatomical structure glutathione decreased amount, abnormal TL + MO1-nfe2l2a Fig. 4 from Sant et al., 2017
anatomical structure glutathione disulfide increased amount, abnormal TL + MO1-nfe2l2a Fig. 4,  Fig. 6 from Sant et al., 2017
caudal hematopoietic tissue blvrb expression increased amount, abnormal TL + MO1-nfe2l2a Fig. 5 from Holowiecki et al., 2017
glutathione disulfide oxidoreductase activity increased occurrence, abnormal TL + MO1-nfe2l2a Fig. 4,  Fig. 6 from Sant et al., 2017
whole organism EGFP expression decreased amount, abnormal it416bTg + MO1-nfe2l2a Fig. S8 from Poganik et al., 2019
whole organism hmox1a expression decreased amount, abnormal TL + MO1-nfe2l2a Fig. 4 from Holowiecki et al., 2017
Phenotype of all Fish created by or utilizing MO1-nfe2l2a
Phenotype Fish Conditions Figures
gill gstp1.2 expression amount, ameliorated AB + MO1-nfe2l2a chemical treatment: tunicamycin Fig. 3 with image from Mukaigasa et al., 2018
gill gstp1.2 expression amount, ameliorated AB + MO1-nfe2l2a chemical treatment: thapsigargin Fig. 3 with image from Mukaigasa et al., 2018
caudal hematopoietic tissue blvrb expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: elemental cadmium Fig. 5 from Holowiecki et al., 2017
whole organism blvrb expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: cadmium dichloride Fig. 8 from Holowiecki et al., 2016
liver hmox1a expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: elemental cadmium Fig. 5 from Holowiecki et al., 2017
caudal hematopoietic tissue blvrb expression increased amount, abnormal TL + MO1-nfe2l2a control Fig. 5 from Holowiecki et al., 2017
whole organism hmox1b expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: cadmium dichloride Fig. 8 from Holowiecki et al., 2016
anatomical structure glutathione disulfide increased amount, abnormal TL + MO1-nfe2l2a chemical treatment by environment: tert-butyl hydroperoxide Fig. 6 from Sant et al., 2017
anatomical structure glutathione decreased amount, abnormal TL + MO1-nfe2l2a standard conditions Fig. 4 from Sant et al., 2017
heart blvrb expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: elemental cadmium Fig. 5 from Holowiecki et al., 2017
anatomical structure glutathione disulfide increased amount, abnormal TL + MO1-nfe2l2a control Fig. 4,  Fig. 6 from Sant et al., 2017
whole organism hmox1a expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: cadmium dichloride Fig. 8 from Holowiecki et al., 2016
glutathione disulfide oxidoreductase activity increased occurrence, abnormal TL + MO1-nfe2l2a control Fig. 4,  Fig. 6 from Sant et al., 2017
glutathione disulfide oxidoreductase activity increased occurrence, exacerbated TL + MO1-nfe2l2a chemical treatment by environment: tert-butyl hydroperoxide Fig. 6 from Sant et al., 2017
whole organism hmox1a expression decreased amount, abnormal TL + MO1-nfe2l2a standard conditions Fig. 4 from Holowiecki et al., 2017
liver blvrb expression amount, ameliorated TL + MO1-nfe2l2a chemical treatment by environment: elemental cadmium Fig. 5 from Holowiecki et al., 2017
whole organism decreased life span, abnormal WT + MO1-nfe2l2a chemical treatment: pharmaceutical Fig. 4 with image from Cox et al., 2014
whole organism EGFP expression decreased amount, abnormal it416bTg + MO1-nfe2l2a control Fig. S8 from Poganik et al., 2019
liver hmox1a expression amount, ameliorated pmm2it768/it768 + MO1-nfe2l2a standard conditions Fig. 1 with image from Mukaigasa et al., 2018
gill gstp1.2 expression increased amount, abnormal pmm2it768/it768 + MO1-nfe2l2a standard conditions Fig. S9 with image from Mukaigasa et al., 2018
gill gstp1.2 expression amount, ameliorated pmm2it768/it768 + MO1-nfe2l2a standard conditions Fig. 1 with image from Mukaigasa et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.