Morpholino

MO1-epha4a

ID
ZDB-MRPHLNO-050522-1
Name
MO1-epha4a
Previous Names
  • EphA4TB (1)
Target
Sequence
5' - AACACAAGCGCAGCCATTGGTGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation blocker.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-epha4a
Expressed Gene Anatomy Figures
efnb2a Fig. S5 from Cooke et al., 2005
efnb3b Fig. S5 from Cooke et al., 2005
egr2b Fig. 1 from Cooke et al., 2005
etv5b Fig. 1 with image from Terriente et al., 2012
fgf20a Fig. 1 with image from Terriente et al., 2012
rac3b Fig. 3 with image from Letelier et al., 2018
rfng Fig. 1 with image from Terriente et al., 2012
sema3gb Fig. 1 from Cooke et al., 2005
Phenotype
Phenotype resulting from MO1-epha4a
Phenotype Fish Figures
abducens motor nucleus adjacent to abducens motor nucleus, abnormal WT + MO1-epha4a Fig. 1 from Cooke et al., 2005
abducens motor nucleus fused with abducens motor nucleus, abnormal WT + MO1-epha4a Fig. 1 from Cooke et al., 2005
rhombomere compartment boundary rac3b expression decreased amount, abnormal ens1Tg + MO1-epha4a Fig. 3 with image from Letelier et al., 2018
rhombomere 2 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53 Fig. 2 with image from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal WT + MO1-epha4a + MO4-tp53 Fig. 6 with image from Addison et al., 2018
rhombomere 3 rhombomere boundary formation process quality, abnormal WT + MO1-epha4a Fig. 1 from Cooke et al., 2005
rhombomere 4 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53 Fig. 2 with image,  Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-epha4a + MO4-tp53 Fig. 6 with image from Addison et al., 2018
rhombomere 5 rhombomere boundary formation process quality, abnormal WT + MO1-epha4a Fig. 1 from Cooke et al., 2005
rhombomere 6 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53 Fig. 2 with image from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal WT + MO1-epha4a + MO4-tp53 Fig. 6 with image from Addison et al., 2018
rhombomere boundary formation process quality, abnormal WT + MO1-epha4a Fig. 1 from Cooke et al., 2005
trigeminal motor nucleus adjacent to trigeminal motor nucleus, abnormal WT + MO1-epha4a Fig. 1 from Cooke et al., 2005
Phenotype of all Fish created by or utilizing MO1-epha4a
Phenotype Fish Conditions Figures
rhombomere 4 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53 standard conditions Fig. 2 with image,  Fig. 6 with image from Addison et al., 2018
rhombomere 6 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53 standard conditions Fig. 2 with image from Addison et al., 2018
rhombomere 2 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53 standard conditions Fig. 2 with image from Addison et al., 2018
rhombomere 3 rhombomere boundary formation process quality, abnormal WT + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
rhombomere 5 rhombomere boundary formation process quality, abnormal WT + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
abducens motor nucleus adjacent to abducens motor nucleus, abnormal WT + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
trigeminal motor nucleus adjacent to trigeminal motor nucleus, abnormal WT + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
rhombomere boundary formation process quality, abnormal WT + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
abducens motor nucleus fused with abducens motor nucleus, abnormal WT + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal WT + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal WT + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere compartment boundary rac3b expression decreased amount, abnormal ens1Tg + MO1-epha4a standard conditions Fig. 3 with image from Letelier et al., 2018
trigeminal motor nucleus fused with trigeminal motor nucleus, abnormal WT + MO1-efnb2a + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
abducens motor nucleus fused with abducens motor nucleus, abnormal WT + MO1-efnb2a + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
rhombomere 5 rhombomere boundary formation process quality, abnormal WT + MO1-efnb2a + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
rhombomere 3 rhombomere boundary formation process quality, abnormal WT + MO1-efnb2a + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
rhombomere boundary formation process quality, abnormal WT + MO1-efnb2a + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
rhombomere boundary formation process quality, abnormal WT + MO1-epha4a + MO2-efnb2a standard conditions Fig. 3 with image from Kemp et al., 2009
rhombomere 3 deformed, abnormal WT + MO1-epha4a + MO2-efnb2a standard conditions Fig. 3 with image from Kemp et al., 2009
rhombomere 5 deformed, abnormal WT + MO1-epha4a + MO2-efnb2a standard conditions Fig. 3 with image from Kemp et al., 2009
rhombomere 4 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal fci3Tg/fci3Tg + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
optic vesicle morphogenesis disrupted, abnormal WT + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 2 with image from Cavodeassi et al., 2013
optic vesicle morphogenesis disrupted, abnormal b1200Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
telencephalon cell migration disrupted, abnormal b1200Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
eye field cell fate commitment involved in camera-type eye formation disrupted, abnormal b1200Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
immature eye cell migration disrupted, abnormal b1200Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
optic vesicle morphogenesis disrupted, abnormal zf460Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
immature eye cell migration disrupted, abnormal zf460Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
telencephalon cell migration disrupted, abnormal zf460Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
eye field cell fate commitment involved in camera-type eye formation disrupted, abnormal zf460Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.