Morpholino

MO1-epha4a

ID

ZDB-MRPHLNO-050522-1

Name

MO1-epha4a

Previous Names

EphA4TB (1)

Target

epha4a (1)

Sequence

5' - AACACAAGCGCAGCCATTGGTGTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation blocker.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-epha4a

No data available

Phenotype

Phenotype resulting from MO1-epha4a

Phenotype	Fish	Figures
abducens motor nucleus adjacent to abducens motor nucleus, abnormal	WT + MO1-epha4a	Fig. 1 from Cooke et al., 2005
abducens motor nucleus fused with abducens motor nucleus, abnormal	WT + MO1-epha4a	Fig. 1 from Cooke et al., 2005
rhombomere compartment boundary rac3b expression decreased amount, abnormal	ens1Tg + MO1-epha4a	Fig. 3 from Letelier et al., 2018
rhombomere 2 Citrine expression increased distribution, abnormal	fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53	Fig. 2 from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal	WT + MO1-epha4a + MO4-tp53	Fig. 6 from Addison et al., 2018
rhombomere 3 rhombomere boundary formation process quality, abnormal	WT + MO1-epha4a	Fig. 1 from Cooke et al., 2005
rhombomere 4 Citrine expression increased distribution, abnormal	fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53	Fig. 2 , Fig. 6 from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal	WT + MO1-epha4a + MO4-tp53	Fig. 6 from Addison et al., 2018
rhombomere 5 rhombomere boundary formation process quality, abnormal	WT + MO1-epha4a	Fig. 1 from Cooke et al., 2005
rhombomere 6 Citrine expression increased distribution, abnormal	fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53	Fig. 2 from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal	WT + MO1-epha4a + MO4-tp53	Fig. 6 from Addison et al., 2018
rhombomere boundary formation process quality, abnormal	WT + MO1-epha4a	Fig. 1 from Cooke et al., 2005
trigeminal motor nucleus adjacent to trigeminal motor nucleus, abnormal	WT + MO1-epha4a	Fig. 1 from Cooke et al., 2005

Phenotype of all Fish created by or utilizing MO1-epha4a

Phenotype	Fish	Conditions	Figures
rhombomere 4 Citrine expression increased distribution, abnormal	fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53	standard conditions	Fig. 2 , Fig. 6 from Addison et al., 2018
rhombomere 6 Citrine expression increased distribution, abnormal	fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53	standard conditions	Fig. 2 from Addison et al., 2018
rhombomere 2 Citrine expression increased distribution, abnormal	fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53	standard conditions	Fig. 2 from Addison et al., 2018
rhombomere 3 rhombomere boundary formation process quality, abnormal	WT + MO1-epha4a	standard conditions	Fig. 1 from Cooke et al., 2005
rhombomere 5 rhombomere boundary formation process quality, abnormal	WT + MO1-epha4a	standard conditions	Fig. 1 from Cooke et al., 2005
abducens motor nucleus adjacent to abducens motor nucleus, abnormal	WT + MO1-epha4a	standard conditions	Fig. 1 from Cooke et al., 2005
trigeminal motor nucleus adjacent to trigeminal motor nucleus, abnormal	WT + MO1-epha4a	standard conditions	Fig. 1 from Cooke et al., 2005
rhombomere boundary formation process quality, abnormal	WT + MO1-epha4a	standard conditions	Fig. 1 from Cooke et al., 2005
abducens motor nucleus fused with abducens motor nucleus, abnormal	WT + MO1-epha4a	standard conditions	Fig. 1 from Cooke et al., 2005
rhombomere 4 egr2b expression mislocalised, abnormal	WT + MO1-epha4a + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal	WT + MO1-epha4a + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal	WT + MO1-epha4a + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere compartment boundary rac3b expression decreased amount, abnormal	ens1Tg + MO1-epha4a	standard conditions	Fig. 3 from Letelier et al., 2018
trigeminal motor nucleus fused with trigeminal motor nucleus, abnormal	WT + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 1 from Cooke et al., 2005
abducens motor nucleus fused with abducens motor nucleus, abnormal	WT + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 1 from Cooke et al., 2005
rhombomere 5 rhombomere boundary formation process quality, abnormal	WT + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 1 from Cooke et al., 2005
rhombomere 3 rhombomere boundary formation process quality, abnormal	WT + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 1 from Cooke et al., 2005
rhombomere boundary formation process quality, abnormal	WT + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 1 from Cooke et al., 2005
rhombomere boundary formation process quality, abnormal	WT + MO1-epha4a + MO2-efnb2a	standard conditions	Fig. 3 from Kemp et al., 2009
rhombomere 3 deformed, abnormal	WT + MO1-epha4a + MO2-efnb2a	standard conditions	Fig. 3 from Kemp et al., 2009
rhombomere 5 deformed, abnormal	WT + MO1-epha4a + MO2-efnb2a	standard conditions	Fig. 3 from Kemp et al., 2009
rhombomere 4 Citrine expression increased distribution, abnormal	fci3Tg/fci3Tg + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal	fci3Tg/fci3Tg + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 4 Citrine expression increased distribution, abnormal	fci3Tg/fci3Tg + MO1-epha4a + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal	fci3Tg/fci3Tg + MO1-epha4a + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal	WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal	WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal	WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53	standard conditions	Fig. 6 from Addison et al., 2018
optic vesicle morphogenesis disrupted, abnormal	WT + MO1-efnb1 + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 2 from Cavodeassi et al., 2013
optic vesicle morphogenesis disrupted, abnormal	b1200Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 4 from Cavodeassi et al., 2013
telencephalon cell migration disrupted, abnormal	b1200Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 4 from Cavodeassi et al., 2013
eye field cell fate commitment involved in camera-type eye formation disrupted, abnormal	b1200Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 4 from Cavodeassi et al., 2013
immature eye cell migration disrupted, abnormal	b1200Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 4 from Cavodeassi et al., 2013
optic vesicle morphogenesis disrupted, abnormal	zf460Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 4 from Cavodeassi et al., 2013
immature eye cell migration disrupted, abnormal	zf460Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 4 from Cavodeassi et al., 2013
telencephalon cell migration disrupted, abnormal	zf460Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 4 from Cavodeassi et al., 2013
eye field cell fate commitment involved in camera-type eye formation disrupted, abnormal	zf460Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a	standard conditions	Fig. 4 from Cavodeassi et al., 2013

Citations