ZFIN ID: ZDB-MRPHLNO-050522-1
Morpholino Name: MO1-epha4a
Target: epha4a (1)
Previous Name: EphA4TB (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AACACAAGCGCAGCCATTGGTGTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation blocker.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-epha4a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-epha4a
Expressed Gene Anatomy Figures
efnb2a Fig. S5 from Cooke et al., 2005
efnb3b Fig. S5 from Cooke et al., 2005
egr2b Fig. 1 from Cooke et al., 2005
etv5b Fig. 1 with image from Terriente et al., 2012
fgf20a Fig. 1 with image from Terriente et al., 2012
rac3b Fig. 3 with image from Letelier et al., 2018
rfng Fig. 1 with image from Terriente et al., 2012
sema3gb Fig. 1 from Cooke et al., 2005
PHENOTYPE
Phenotype resulting from MO1-epha4a
Phenotype of all Fish created by or utilizing MO1-epha4a
Phenotype Fish Conditions Figures
rhombomere 4 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53 standard conditions Fig. 2 with imageFig. 6 with image from Addison et al., 2018
rhombomere 6 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53 standard conditions Fig. 2 with image from Addison et al., 2018
rhombomere 2 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO4-tp53 standard conditions Fig. 2 with image from Addison et al., 2018
rhombomere 3 rhombomere boundary formation process quality, abnormal WT + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
rhombomere 5 rhombomere boundary formation process quality, abnormal WT + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
abducens motor nucleus adjacent to abducens motor nucleus, abnormal WT + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
trigeminal motor nucleus adjacent to trigeminal motor nucleus, abnormal WT + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
rhombomere boundary formation process quality, abnormal WT + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
abducens motor nucleus fused with abducens motor nucleus, abnormal WT + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal WT + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal WT + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere compartment boundary rac3b expression decreased amount, abnormal ens1Tg + MO1-epha4a standard conditions Fig. 3 with image from Letelier et al., 2018
trigeminal motor nucleus fused with trigeminal motor nucleus, abnormal WT + MO1-efnb2a + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
abducens motor nucleus fused with abducens motor nucleus, abnormal WT + MO1-efnb2a + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
rhombomere 5 rhombomere boundary formation process quality, abnormal WT + MO1-efnb2a + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
rhombomere 3 rhombomere boundary formation process quality, abnormal WT + MO1-efnb2a + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
rhombomere boundary formation process quality, abnormal WT + MO1-efnb2a + MO1-epha4a standard conditions Fig. 1 from Cooke et al., 2005
rhombomere boundary formation process quality, abnormal WT + MO1-epha4a + MO2-efnb2a standard conditions Fig. 3 with image from Kemp et al., 2009
rhombomere 3 deformed, abnormal WT + MO1-epha4a + MO2-efnb2a standard conditions Fig. 3 with image from Kemp et al., 2009
rhombomere 5 deformed, abnormal WT + MO1-epha4a + MO2-efnb2a standard conditions Fig. 3 with image from Kemp et al., 2009
rhombomere 4 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal fci3Tg/fci3Tg + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 6 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal WT + MO1-cyp26b1 + MO1-cyp26c1 + MO1-epha4a + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
optic vesicle morphogenesis disrupted, abnormal WT + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 2 with image from Cavodeassi et al., 2013
optic vesicle morphogenesis disrupted, abnormal b1200Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
telencephalon cell migration disrupted, abnormal b1200Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
eye field cell fate commitment involved in camera-type eye formation disrupted, abnormal b1200Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
immature eye cell migration disrupted, abnormal b1200Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
optic vesicle morphogenesis disrupted, abnormal zf460Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
immature eye cell migration disrupted, abnormal zf460Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
telencephalon cell migration disrupted, abnormal zf460Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
eye field cell fate commitment involved in camera-type eye formation disrupted, abnormal zf460Tg + MO1-efnb1 + MO1-efnb2a + MO1-epha4a standard conditions Fig. 4 with image from Cavodeassi et al., 2013
Genome Resources:
CITATIONS (8)