Morpholino

MO1-ift88

ID
ZDB-MRPHLNO-050506-1
Name
MO1-ift88
Previous Names
  • MO1-ttc10 (1)
  • polarisAUG (1)
Target
Sequence
5' - CTGGGACAAGATGCACATTCTCCAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino targeting the ift88 gene.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ift88
Expressed Gene Anatomy Figures
klf2a Figure 4 with image from Li et al., 2020
klf2b Figure 4 with image from Li et al., 2020
myb Fig. 3 with image from Liu et al., 2019
nkx2.2a Fig. 5 from Evron et al., 2011
notch1b Figure 4 with image from Li et al., 2020
pax2a Fig. 5 from Evron et al., 2011
pitx2 Fig. 7 with image from Kramer-Zucker et al., 2005
runx1 Fig. 3 with image,  Fig. 5 with image from Liu et al., 2019
spaw Fig. 7 with image from Kramer-Zucker et al., 2005
Phenotype
Phenotype resulting from MO1-ift88
Phenotype Fish Figures
blood vessel cilium decreased amount, abnormal hsc5Tg; pku6Tg + MO1-ift88 Fig. 2 with image from Liu et al., 2019
embryo development disrupted, abnormal WT + MO1-ift88 Fig. 5 from Evron et al., 2011
establishment of mitotic spindle orientation disrupted, abnormal WT + MO1-ift88 Fig. 1 from Delaval et al., 2011
heart klf2a expression increased amount, abnormal WT + MO1-ift88 Figure 4 with image from Li et al., 2020
heart cilium decreased amount, abnormal WT + MO1-ift88 Figure 4 with image from Li et al., 2020
hematopoietic progenitor cell differentiation decreased occurrence, abnormal ift88tz288/tz288 + MO1-ift88 Fig. 3 with image,  Fig. 5 with image from Liu et al., 2019
mitotic cell cycle process quality, abnormal WT + MO1-ift88 Fig. S2 from Delaval et al., 2011
muscle pioneer decreased amount, abnormal WT + MO1-ift88 Fig. 6 from Evron et al., 2011
posterior neural tube cilium decreased amount, abnormal WT + MO1-ift88 Fig. 8 from Evron et al., 2011
pronephric duct mitotic spindle direction, abnormal WT + MO1-ift88 Fig. 1 from Delaval et al., 2011
pronephros cystic, abnormal TU + MO1-ift88 Fig. 7 from Jin et al., 2019
pronephros multi-ciliated epithelial cell lacks parts or has fewer parts of type multi-ciliated epithelial cell cilium, abnormal WT + MO1-ift88 Fig. 5 from Pathak et al., 2014
slow muscle cell decreased amount, abnormal WT + MO1-ift88 Fig. 6 from Evron et al., 2011
somite disorganized, abnormal WT + MO1-ift88 Fig. 5 from Evron et al., 2011
trunk curved, abnormal WT + MO1-ift88 Fig. 5 from Evron et al., 2011
ventral wall of dorsal aorta myb expression decreased amount, abnormal AB + MO1-ift88 Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal AB + MO1-ift88 Fig. 3 with image,  Fig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal AB + MO1-ift88 Fig. 3 with image,  Fig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta myb expression decreased distribution, abnormal AB + MO1-ift88 Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta endothelial cell mCherry expression decreased amount, abnormal jh11Tg; y1Tg + MO1-ift88 Fig. 6 with image from Liu et al., 2019
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal AB + MO1-ift88 Fig. 5 with image from Liu et al., 2019
Phenotype of all Fish created by or utilizing MO1-ift88
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal ift88tz288/tz288 + MO1-ift88 control Fig. 3 with image from Liu et al., 2019
hematopoietic progenitor cell differentiation decreased occurrence, abnormal ift88tz288/tz288 + MO1-ift88 control Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal ift88tz288/tz288 + MO1-ift88 control Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal AB + MO1-ift88 control Fig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal AB + MO1-ift88 control Fig. 3 with image,  Fig. 5 with image from Liu et al., 2019
hematopoietic progenitor cell differentiation decreased occurrence, abnormal AB + MO1-ift88 control Fig. 3 with image,  Fig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta myb expression decreased distribution, abnormal AB + MO1-ift88 control Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta myb expression decreased amount, abnormal AB + MO1-ift88 control Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal AB + MO1-ift88 control Fig. 3 with image,  Fig. 5 with image from Liu et al., 2019
pronephros cystic, abnormal TU + MO1-ift88 standard conditions Fig. 7 from Jin et al., 2019
heart klf2a expression increased amount, abnormal WT + MO1-ift88 control Figure 4 with image from Li et al., 2020
atrioventricular canal klf2b expression amount, ameliorated WT + MO1-ift88 chemical treatment by environment: metronidazole Figure 4 with image from Li et al., 2020
pronephric duct mitotic spindle direction, abnormal WT + MO1-ift88 standard conditions Fig. 1 from Delaval et al., 2011
posterior neural tube cilium decreased amount, abnormal WT + MO1-ift88 standard conditions Fig. 8 from Evron et al., 2011
muscle pioneer decreased amount, abnormal WT + MO1-ift88 standard conditions Fig. 6 from Evron et al., 2011
trunk curved, abnormal WT + MO1-ift88 standard conditions Fig. 5 from Evron et al., 2011
establishment of mitotic spindle orientation disrupted, abnormal WT + MO1-ift88 standard conditions Fig. 1 from Delaval et al., 2011
somite disorganized, abnormal WT + MO1-ift88 standard conditions Fig. 5 from Evron et al., 2011
slow muscle cell decreased amount, abnormal WT + MO1-ift88 standard conditions Fig. 6 from Evron et al., 2011
heart cilium decreased amount, abnormal WT + MO1-ift88 standard conditions Figure 4 with image from Li et al., 2020
pronephros multi-ciliated epithelial cell lacks parts or has fewer parts of type multi-ciliated epithelial cell cilium, abnormal WT + MO1-ift88 standard conditions Fig. 5 from Pathak et al., 2014
mitotic cell cycle process quality, abnormal WT + MO1-ift88 standard conditions Fig. S2 from Delaval et al., 2011
embryo development disrupted, abnormal WT + MO1-ift88 standard conditions Fig. 5 from Evron et al., 2011
heart nrg1 expression decreased amount, abnormal twu26Tg + MO1-ift88 + MO3-ift88 control Fig. 6 with image from Samsa et al., 2015
heart notch1b expression decreased amount, abnormal twu26Tg + MO1-ift88 + MO3-ift88 control Fig. 6 with image from Samsa et al., 2015
blood vessel cilium decreased amount, abnormal hsc5Tg; pku6Tg + MO1-ift88 control Fig. 2 with image from Liu et al., 2019
ventral wall of dorsal aorta endothelial cell mCherry expression decreased amount, abnormal jh11Tg; y1Tg + MO1-ift88 control Fig. 6 with image from Liu et al., 2019
cardiac ventricle Venus expression decreased amount, abnormal s940Tg; vc6Tg + MO1-ift88 + MO3-ift88 control Fig. 6 with image from Samsa et al., 2015
atrioventricular canal endocardium Venus expression decreased amount, abnormal s940Tg; vc6Tg + MO1-ift88 + MO3-ift88 control Fig. 6 with image from Samsa et al., 2015
trabecular layer absent, abnormal s940Tg; vc6Tg + MO1-ift88 + MO3-ift88 control Fig. 6 with image from Samsa et al., 2015
pronephros cystic, abnormal TU + MO1-cldn3c + MO1-ift88 standard conditions Fig. 7 from Jin et al., 2019
pronephros cystic, exacerbated TU + MO1-cldn7b + MO1-ift88 standard conditions Fig. 7 from Jin et al., 2019
heart tube position, abnormal WT + MO1-ift88 + MO1-ippk standard conditions Fig. 3 with image,  Fig. S7 with image from Sarmah et al., 2007
pericardium edematous, abnormal WT + MO1-ift88 + MO2-yap1 control Fig. 7 from He et al., 2015
pronephros cystic, abnormal WT + MO1-ift88 + MO2-yap1 control Fig. 7 from He et al., 2015
caudal fin curved, abnormal WT + MO1-ift88 + MO2-yap1 control Fig. 7 from He et al., 2015
eye decreased size, abnormal WT + MO1-ift88 + MO2-yap1 control Fig. 7 from He et al., 2015
heart Notch signaling pathway occurrence, ameliorated mw43Tg; s957Tg + MO1-ift88 chemical treatment by environment: metronidazole Figure 4 with image from Li et al., 2020
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal pku6Tg; zf169Tg + MO1-ift88 control Fig. 5 with image from Liu et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.