Morpholino

MO1-ift88

ID
ZDB-MRPHLNO-050506-1
Name
MO1-ift88
Previous Names
  • MO1-ttc10 (1)
  • polarisAUG (1)
Target
Sequence
5' - CTGGGACAAGATGCACATTCTCCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino targeting the ift88 gene.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ift88
No data available
Phenotype
Phenotype resulting from MO1-ift88
Phenotype Fish Figures
blood vessel cilium decreased amount, abnormal hsc5Tg; pku6Tg + MO1-ift88 Fig. 2 with image from Liu et al., 2019
embryo development disrupted, abnormal WT + MO1-ift88 Fig. 5 from Evron et al., 2011
establishment of mitotic spindle orientation disrupted, abnormal WT + MO1-ift88 Fig. 1 from Delaval et al., 2011
heart klf2a expression increased amount, abnormal WT + MO1-ift88 Figure 4 with image from Li et al., 2020
heart cilium decreased amount, abnormal WT + MO1-ift88 Figure 4 with image from Li et al., 2020
hematopoietic progenitor cell differentiation decreased occurrence, abnormal AB + MO1-ift88 Fig. 3 with imageFig. 5 with image from Liu et al., 2019
mitotic cell cycle process quality, abnormal WT + MO1-ift88 Fig. S2 from Delaval et al., 2011
muscle pioneer decreased amount, abnormal WT + MO1-ift88 Fig. 6 from Evron et al., 2011
posterior neural tube cilium decreased amount, abnormal WT + MO1-ift88 Fig. 8 from Evron et al., 2011
pronephric duct mitotic spindle direction, abnormal WT + MO1-ift88 Fig. 1 from Delaval et al., 2011
pronephros cystic, abnormal TU + MO1-ift88 Fig. 7 from Jin et al., 2019
pronephros multi-ciliated epithelial cell lacks parts or has fewer parts of type multi-ciliated epithelial cell cilium, abnormal WT + MO1-ift88 Fig. 5 from Pathak et al., 2014
slow muscle cell decreased amount, abnormal WT + MO1-ift88 Fig. 6 from Evron et al., 2011
somite disorganized, abnormal WT + MO1-ift88 Fig. 5 from Evron et al., 2011
trunk curved, abnormal WT + MO1-ift88 Fig. 5 from Evron et al., 2011
ventral wall of dorsal aorta myb expression decreased amount, abnormal AB + MO1-ift88 Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal AB + MO1-ift88 Fig. 3 with imageFig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal AB + MO1-ift88 Fig. 3 with imageFig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta myb expression decreased distribution, abnormal AB + MO1-ift88 Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta endothelial cell mCherry expression decreased amount, abnormal jh11Tg; y1Tg + MO1-ift88 Fig. 6 with image from Liu et al., 2019
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal AB + MO1-ift88 Fig. 5 with image from Liu et al., 2019
Phenotype of all Fish created by or utilizing MO1-ift88
Phenotype Fish Conditions Figures
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal ift88tz288/tz288 + MO1-ift88 control Fig. 3 with image from Liu et al., 2019
hematopoietic progenitor cell differentiation decreased occurrence, abnormal ift88tz288/tz288 + MO1-ift88 control Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal ift88tz288/tz288 + MO1-ift88 control Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal AB + MO1-ift88 control Fig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta runx1 expression decreased distribution, abnormal AB + MO1-ift88 control Fig. 3 with imageFig. 5 with image from Liu et al., 2019
hematopoietic progenitor cell differentiation decreased occurrence, abnormal AB + MO1-ift88 control Fig. 3 with imageFig. 5 with image from Liu et al., 2019
ventral wall of dorsal aorta myb expression decreased distribution, abnormal AB + MO1-ift88 control Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta myb expression decreased amount, abnormal AB + MO1-ift88 control Fig. 3 with image from Liu et al., 2019
ventral wall of dorsal aorta runx1 expression decreased amount, abnormal AB + MO1-ift88 control Fig. 3 with imageFig. 5 with image from Liu et al., 2019
pronephros cystic, abnormal TU + MO1-ift88 standard conditions Fig. 7 from Jin et al., 2019
heart klf2a expression increased amount, abnormal WT + MO1-ift88 control Figure 4 with image from Li et al., 2020
atrioventricular canal klf2b expression amount, ameliorated WT + MO1-ift88 chemical treatment by environment: metronidazole Figure 4 with image from Li et al., 2020
pronephric duct mitotic spindle direction, abnormal WT + MO1-ift88 standard conditions Fig. 1 from Delaval et al., 2011
posterior neural tube cilium decreased amount, abnormal WT + MO1-ift88 standard conditions Fig. 8 from Evron et al., 2011
muscle pioneer decreased amount, abnormal WT + MO1-ift88 standard conditions Fig. 6 from Evron et al., 2011
trunk curved, abnormal WT + MO1-ift88 standard conditions Fig. 5 from Evron et al., 2011
establishment of mitotic spindle orientation disrupted, abnormal WT + MO1-ift88 standard conditions Fig. 1 from Delaval et al., 2011
somite disorganized, abnormal WT + MO1-ift88 standard conditions Fig. 5 from Evron et al., 2011
slow muscle cell decreased amount, abnormal WT + MO1-ift88 standard conditions Fig. 6 from Evron et al., 2011
pronephros multi-ciliated epithelial cell lacks parts or has fewer parts of type multi-ciliated epithelial cell cilium, abnormal WT + MO1-ift88 standard conditions Fig. 5 from Pathak et al., 2014
heart cilium decreased amount, abnormal WT + MO1-ift88 standard conditions Figure 4 with image from Li et al., 2020
mitotic cell cycle process quality, abnormal WT + MO1-ift88 standard conditions Fig. S2 from Delaval et al., 2011
embryo development disrupted, abnormal WT + MO1-ift88 standard conditions Fig. 5 from Evron et al., 2011
heart nrg1 expression decreased amount, abnormal twu26Tg + MO1-ift88 + MO3-ift88 control Fig. 6 with image from Samsa et al., 2015
heart notch1b expression decreased amount, abnormal twu26Tg + MO1-ift88 + MO3-ift88 control Fig. 6 with image from Samsa et al., 2015
blood vessel cilium decreased amount, abnormal hsc5Tg; pku6Tg + MO1-ift88 control Fig. 2 with image from Liu et al., 2019
ventral wall of dorsal aorta endothelial cell mCherry expression decreased amount, abnormal jh11Tg; y1Tg + MO1-ift88 control Fig. 6 with image from Liu et al., 2019
cardiac ventricle Venus expression decreased amount, abnormal s940Tg; vc6Tg + MO1-ift88 + MO3-ift88 control Fig. 6 with image from Samsa et al., 2015
atrioventricular canal endocardium Venus expression decreased amount, abnormal s940Tg; vc6Tg + MO1-ift88 + MO3-ift88 control Fig. 6 with image from Samsa et al., 2015
trabecular layer absent, abnormal s940Tg; vc6Tg + MO1-ift88 + MO3-ift88 control Fig. 6 with image from Samsa et al., 2015
pronephros cystic, abnormal TU + MO1-cldn3c + MO1-ift88 standard conditions Fig. 7 from Jin et al., 2019
pronephros cystic, exacerbated TU + MO1-cldn7b + MO1-ift88 standard conditions Fig. 7 from Jin et al., 2019
heart tube position, abnormal WT + MO1-ift88 + MO1-ippk standard conditions Fig. 3 with imageFig. S7 with image from Sarmah et al., 2007
pericardium edematous, abnormal WT + MO1-ift88 + MO2-yap1 control Fig. 7 from He et al., 2015
pronephros cystic, abnormal WT + MO1-ift88 + MO2-yap1 control Fig. 7 from He et al., 2015
caudal fin curved, abnormal WT + MO1-ift88 + MO2-yap1 control Fig. 7 from He et al., 2015
eye decreased size, abnormal WT + MO1-ift88 + MO2-yap1 control Fig. 7 from He et al., 2015
heart Notch signaling pathway occurrence, ameliorated mw43Tg; s957Tg + MO1-ift88 chemical treatment by environment: metronidazole Figure 4 with image from Li et al., 2020
ventral wall of dorsal aorta hematopoietic multipotent progenitor cell decreased amount, abnormal pku6Tg; zf169Tg + MO1-ift88 control Fig. 5 with image from Liu et al., 2019
Citations