ZFIN ID: ZDB-MRPHLNO-050421-2
Morpholino Name: MO4-cdh1
Target: cdh1 (1)
Previous Name: mphEcad-m54-m79 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TAAATCGCAGCTCTTCCTTCCAACG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO4-cdh1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO4-cdh1
Expressed Gene Anatomy Figures
foxj1a Fig. 6 from Wang et al., 2017
sox17 Fig. 6 from Wang et al., 2017
PHENOTYPE
Phenotype resulting from MO4-cdh1
Phenotype of all Fish created by or utilizing MO4-cdh1
Genome Resources:
CITATIONS (9)