Morpholino

MO1-foxa2

ID

ZDB-MRPHLNO-050228-2

Name

MO1-foxa2

Previous Names

None

Target

foxa2 (1)

Sequence

5' - CCTCCATTTTGACAGCACCGAGCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-foxa2

No data available

Phenotype

Phenotype resulting from MO1-foxa2

Phenotype	Fish	Figures
exocrine pancreas decreased size, abnormal	gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	Fig. 7 from Shin et al., 2008
floor plate undifferentiated, abnormal	WT + MO1-foxa2	Fig. 1 from Dal-Pra et al., 2011
liver decreased size, abnormal	gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	Fig. 7 from Shin et al., 2008
liver development disrupted, abnormal	gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	Fig. 7 from Shin et al., 2008
pancreas decreased size, abnormal	WT + MO1-foxa2	Fig. 7 from Shin et al., 2008
pancreas development disrupted, abnormal	WT + MO1-foxa2	Fig. 7 from Shin et al., 2008
post-vent region curved ventral, abnormal	WT + MO1-foxa2	Fig. 1 from Dal-Pra et al., 2011

Phenotype of all Fish created by or utilizing MO1-foxa2

Phenotype	Fish	Conditions	Figures
floor plate undifferentiated, abnormal	WT + MO1-foxa2	standard conditions	Fig. 1 from Dal-Pra et al., 2011
post-vent region curved ventral, abnormal	WT + MO1-foxa2	standard conditions	Fig. 1 from Dal-Pra et al., 2011
pancreas development disrupted, abnormal	WT + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
pancreas decreased size, abnormal	WT + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
exocrine pancreas decreased size, abnormal	gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
liver development disrupted, abnormal	gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
pancreas development disrupted, abnormal	gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
liver decreased size, abnormal	gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
liver development disrupted, abnormal	med12^s432/+ + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
pancreas decreased size, abnormal	med12^s432/+ + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
pancreas development disrupted, abnormal	med12^s432/+ + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
liver decreased size, abnormal	med12^s432/+ + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
pancreas development disrupted, abnormal	med12^s432/s432 + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
liver development disrupted, abnormal	med12^s432/s432 + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
pancreas aplastic, abnormal	med12^s432/s432 + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
liver aplastic, abnormal	med12^s432/s432 + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
gut duplicated, abnormal	AB + MO1-foxa2 + MO3-sox17	standard conditions	Fig. 6 from Muto et al., 2011
pancreas duplicated, abnormal	AB + MO1-foxa2 + MO3-sox17	standard conditions	Fig. 6 from Muto et al., 2011
liver duplicated, abnormal	AB + MO1-foxa2 + MO3-sox17	standard conditions	Fig. 6 from Muto et al., 2011
axial chorda mesoderm decreased width, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 3 , Fig. 8 from Dal-Pra et al., 2011
notochord posterior region truncated, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. S2 from Dal-Pra et al., 2011
somite fused with somite, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 from Dal-Pra et al., 2011
notochord cell decreased size, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. S1 from Dal-Pra et al., 2011
hypochord decreased length, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. S2 from Dal-Pra et al., 2011
notochord cell mislocalised, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. S1 from Dal-Pra et al., 2011
hypochord disorganized, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. 8 , Fig. S2 from Dal-Pra et al., 2011
floor plate disorganized, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. 8 , Fig. S2 from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 3 , Fig. 8 from Dal-Pra et al., 2011
floor plate cell elongated, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. S1 from Dal-Pra et al., 2011
axial chorda mesoderm aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 3 from Dal-Pra et al., 2011
floor plate decreased length, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. S2 from Dal-Pra et al., 2011
notochord disorganized, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3	standard conditions	Fig. 1 , Fig. 8 , Fig. S2 from Dal-Pra et al., 2011
intestine goblet cell agr2 expression decreased amount, abnormal	WT + MO1-foxa2 + MO3-hif1ab	standard conditions	Fig. 6 from Lai et al., 2016
goblet cell cell maturation disrupted, abnormal	WT + MO1-foxa2 + MO3-hif1ab	standard conditions	Fig. 6 from Lai et al., 2016
hypochord aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3	standard conditions	Fig. S2 from Dal-Pra et al., 2011
notochord aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3	standard conditions	Fig. S2 from Dal-Pra et al., 2011
floor plate aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa1 + MO2-foxa3	standard conditions	Fig. S2 from Dal-Pra et al., 2011
paraxial mesoderm increased area, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
hypochord aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
floor plate aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
axial chorda mesoderm aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
notochord aplastic, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
paraxial mesoderm left side fused with paraxial mesoderm right side, abnormal	WT + MO1-foxa2 + MO1-foxa3 + MO2-foxa3 + MO2-noto	standard conditions	Fig. 8 from Dal-Pra et al., 2011
liver development disrupted, abnormal	med12^s432/+; gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
exocrine pancreas decreased size, abnormal	med12^s432/+; gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
pancreas development disrupted, abnormal	med12^s432/+; gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008
liver decreased size, abnormal	med12^s432/+; gz2Tg; gz4Tg; m1018Tg + MO1-foxa2	standard conditions	Fig. 7 from Shin et al., 2008

Citations