Morpholino

MO1-prox1a

ID

ZDB-MRPHLNO-050225-3

Name

MO1-prox1a

Previous Names

Target

Sequence

5' - ATGTGCTGTCATGGTCAGGCATCAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-prox1a

Expressed Gene	Anatomy	Figures
cdh5	blood vasculature	Fig. 6 from Flores et al., 2010
ins	pancreatic bud	Fig. 8 from Liu et al., 2003
lyve1b	(not) whole organism	Fig. 6 from Flores et al., 2010
neurog1	central nervous system hypothalamus	Fig. S5 from Pistocchi et al., 2008
nr5a1a	head kidney	Fig. 8 from Liu et al., 2003
otpb	caudal tuberculum hypophysis hypothalamus preoptic area rhombomere	Fig. 3 from Pistocchi et al., 2008
prox2	lens rhombomere 5 rhombomere 6	Fig. S1 from Pistocchi et al., 2008
shha	central nervous system diencephalon	Fig. S4 from Pistocchi et al., 2008
th	caudal tuberculum hypothalamus	Fig. 2 , Fig. S3 , Fig. S7 from Pistocchi et al., 2008

Phenotype

Phenotype resulting from MO1-prox1a

Phenotype	Fish	Figures
hypothalamus neuron decreased amount, abnormal	AB + MO1-prox1a	Fig. 2 , Fig. 3 , Fig. S3 from Pistocchi et al., 2008
lymphangiogenesis disrupted, abnormal	y1Tg + MO1-prox1a	Fig. 2 from Yaniv et al., 2007
lymphatic endothelial cell differentiation disrupted, abnormal	WT + MO1-prox1a	Fig. 6 from Flores et al., 2010
neuromast somatic stem cell immature, abnormal	s356tTg + MO1-prox1a	Fig. 5 from Pistocchi et al., 2009
neuromast hair cell decreased amount, abnormal	WT + MO1-prox1a	Fig. 5 , Fig. S1 from Pistocchi et al., 2009
neuromast hair cell kinocilium absent, abnormal	WT + MO1-prox1a	Fig. 4 from Pistocchi et al., 2009
posterior lateral line neuromast decreased amount, abnormal	WT + MO1-prox1a	Fig. 3 , Fig. S1 from Pistocchi et al., 2009
thoracic duct absent, abnormal	ncv2Tg; ncv8Tg + MO1-prox1a	Fig. S2 from Wakayama et al., 2015
thoracic duct aplastic, abnormal	y1Tg + MO1-prox1a	Fig. 2 from Yaniv et al., 2007

Phenotype of all Fish created by or utilizing MO1-prox1a

Phenotype	Fish	Conditions	Figures
hypothalamus neuron decreased amount, abnormal	AB + MO1-prox1a	standard conditions	Fig. 2 , Fig. 3 , Fig. S3 from Pistocchi et al., 2008
lymphatic endothelial cell differentiation disrupted, abnormal	WT + MO1-prox1a	standard conditions	Fig. 6 from Flores et al., 2010
neuromast hair cell kinocilium absent, abnormal	WT + MO1-prox1a	standard conditions	Fig. 4 from Pistocchi et al., 2009
neuromast hair cell decreased amount, abnormal	WT + MO1-prox1a	standard conditions	Fig. S1 from Pistocchi et al., 2009
posterior lateral line neuromast decreased amount, abnormal	WT + MO1-prox1a	standard conditions	Fig. 3 , Fig. S1 from Pistocchi et al., 2009
neuromast hair cell decreased amount, abnormal	s356tTg + MO1-prox1a	standard conditions	Fig. 5 from Pistocchi et al., 2009
neuromast somatic stem cell immature, abnormal	s356tTg + MO1-prox1a	standard conditions	Fig. 5 from Pistocchi et al., 2009
lymphangiogenesis disrupted, abnormal	y1Tg + MO1-prox1a	standard conditions	Fig. 2 from Yaniv et al., 2007
thoracic duct aplastic, abnormal	y1Tg + MO1-prox1a	standard conditions	Fig. 2 from Yaniv et al., 2007
thoracic duct absent, abnormal	ncv2Tg; ncv8Tg + MO1-prox1a	standard conditions	Fig. S2 from Wakayama et al., 2015

Citations