Morpholino

MO1-tdgf1

ID

ZDB-MRPHLNO-050221-2

Name

MO1-tdgf1

Previous Names

Target

Sequence

5' - GCCAATAAACTCCAAAACAACTCGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Effects are severe cyclopia, somite absence in trunk, misshapen tail somites, and reduced notochord.

Genome Resources

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-tdgf1

Expressed Gene	Anatomy	Figures
fgfrl1a	palatoquadrate arch pharyngeal pouch ventral hyoid arch	Fig. 3 , text only from Hall et al., 2006
myl7	cardiac muscle cell	Fig. 3 from Deshwar et al., 2016

Phenotype

Phenotype resulting from MO1-tdgf1

Phenotype	Fish	Figures
larval heart development decreased process quality, abnormal	WT + MO1-tdgf1	Fig. 3 from Deshwar et al., 2016
nodal signaling pathway decreased occurrence, abnormal	WT + MO1-tdgf1	Fig. 2 from Deshwar et al., 2016
tail bud increased size, abnormal	WT + MO1-tdgf1	Fig. 3 from O'Neill et al., 2013
whole organism physical object quality, abnormal	WT + MO1-tdgf1 + MO4-tp53	Fig. S6 from Moreno-Ayala et al., 2015

Phenotype of all Fish created by or utilizing MO1-tdgf1

Phenotype	Fish	Conditions	Figures
tail bud increased size, abnormal	WT + MO1-tdgf1	standard conditions	Fig. 3 from O'Neill et al., 2013
nodal signaling pathway decreased occurrence, abnormal	WT + MO1-tdgf1	standard conditions	Fig. 2 from Deshwar et al., 2016
larval heart development decreased process quality, abnormal	WT + MO1-tdgf1	standard conditions	Fig. 3 from Deshwar et al., 2016
whole organism physical object quality, abnormal	WT + MO1-tdgf1 + MO4-tp53	standard conditions	Fig. S6 from Moreno-Ayala et al., 2015
tail bud increased size, abnormal	WT + MO1-tdgf1 + MO4-tp53	standard conditions	Fig. 3 from O'Neill et al., 2013
whole organism physical object quality, abnormal	WT + MO1-tdgf1 + MO1-zmiz2 + MO4-tp53	standard conditions	Fig. S6 from Moreno-Ayala et al., 2015
eye fused with eye, abnormal	WT + MO1-tdgf1 + MO2-aplnrb + MO7-aplnra	standard conditions	Fig. 3 from Deshwar et al., 2016
cardiac muscle cell myl7 expression absent, abnormal	WT + MO1-tdgf1 + MO2-aplnrb + MO7-aplnra	standard conditions	Fig. 3 from Deshwar et al., 2016
larval heart development decreased process quality, abnormal	WT + MO1-tdgf1 + MO2-aplnrb + MO7-aplnra	standard conditions	Fig. 3 from Deshwar et al., 2016

Citations