Morpholino
MO1-tdgf1
- ID
- ZDB-MRPHLNO-050221-2
- Name
- MO1-tdgf1
- Previous Names
-
- oep-MO (1)
- Target
- Sequence
-
5' - GCCAATAAACTCCAAAACAACTCGA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Effects are severe cyclopia, somite absence in trunk, misshapen tail somites, and reduced notochord.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tdgf1
No data available
Phenotype
Phenotype resulting from MO1-tdgf1
1 - 4 of 4
Phenotype of all Fish created by or utilizing MO1-tdgf1
1 - 5 of 9 Show all
Citations
- Garland, M.A., Sengupta, S., Mathew, L.K., Truong, L., de Jong, E., Piersma, A.H., La Du, J., Tanguay, R.L. (2019) Glucocorticoid receptor-dependent induction of cripto-1 (one-eyed pinhead) inhibits zebrafish caudal fin regeneration. Toxicology reports. 6:529-537
- Deshwar, A.R., Chng, S.C., Ho, L., Reversade, B., Scott, I.C. (2016) The Apelin receptor enhances Nodal/TGFβ signaling to ensure proper cardiac development. eLIFE. 5
- Xue, Y., Xing, C., Zhang, W., Chen, C., Xu, J., Meng, A., Pan, Y. (2016) Coordinate involvement of Nodal-dependent inhibition and Wnt-dependent activation in the maintenance of organizer-specific bmp2b in zebrafish. The International journal of developmental biology. 60(1-2-3):13-19
- Moreno-Ayala, R., Schnabel, D., Salas-Vidal, E., Lomelí, H. (2015) PIAS-like protein Zimp7 is required for the restriction of the Zebrafish organizer and mesoderm development. Developmental Biology. 403(1):89-100
- O'Neill, K., and Thorpe, C. (2013) BMP signaling and spadetail regulate exit of muscle precursors from the zebrafish tailbud. Developmental Biology. 375(2):117-127
- Chen, Y.Y., Harris, M.P., Levesque, M.P., Nüsslein-Volhard, C., and Sonawane, M. (2012) Heterogeneity across the dorso-ventral axis in zebrafish EVL is regulated by a novel module consisting of sox, snail1a and max genes. Mechanisms of Development. 129(1-4):13-23
- Kwon, H.J., and Riley, B.B. (2009) Mesendodermal signals required for otic induction: Bmp-antagonists cooperate with Fgf and can facilitate formation of ectopic otic tissue. Developmental Dynamics : an official publication of the American Association of Anatomists. 238(6):1582-1594
- Hall, C., Flores, M.V., Murison, G., Crosier, K., and Crosier, P. (2006) An essential role for zebrafish Fgfrl1 during gill cartilage development. Mechanisms of Development. 123(12):925-940
- Feldman, B. and Stemple, D.L. (2001) Morpholino phenocopies of sqt, oep, and ntl mutations. Genesis (New York, N.Y. : 2000). 30(3):175-177
- Phillips, B.T., Bolding, K., and Riley, B.B. (2001) Zebrafish fgf3 and fgf8 encode redundant functions required for otic placode induction. Developmental Biology. 235(2):351-365
1 - 10 of 11
Show