ZFIN ID: ZDB-MRPHLNO-050208-13
Morpholino Name: MO2-dlx3b
Target: dlx3b
Previous Name: dlx3-1 MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ATATGTCGGTCCACTCATCCTTAAT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a dlx3b translation blocker. Mackereth et al. (2005) shows an extra T near the 3'-end due to a misprint. The correct sequence is displayed here.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-dlx3b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-dlx3b
Expressed Gene Anatomy Figures
anxa5b Fig. 4 with image from Solomon et al., 2002
dlx3b Fig. 8 with image from Mackereth et al., 2005
Fig. 6 with image from Solomon et al., 2002
dlx4b Fig. 6 with image from Solomon et al., 2002
eya1 Fig. 4 with image from Solomon et al., 2002
pax2a Fig. 8 with image from Mackereth et al., 2005
Fig. 5 with image from Solomon et al., 2002
pax8 Fig. 5 with image from Solomon et al., 2002
PHENOTYPE
Phenotype resulting from MO2-dlx3b
Phenotype of all Fish created by or utilizing MO2-dlx3b
Phenotype Fish Conditions Figures
otic vesicle decreased size, abnormal WT + MO2-dlx3b standard conditions Fig. 2 with image from Solomon et al., 2002
otic vesicle development process quality, abnormal WT + MO2-dlx3b standard conditions Fig. 4 with image from Solomon et al., 2002
olfactory placode development process quality, abnormal WT + MO2-dlx3b standard conditions Fig. 4 with image from Solomon et al., 2002
otolith decreased amount, abnormal WT + MO2-dlx3b standard conditions Fig. 2 with image from Solomon et al., 2002
otolith absent, abnormal WT + MO2-dlx3b + MO4-dlx4b standard conditions Fig. 2 with image from Solomon et al., 2002
olfactory placode formation arrested, abnormal WT + MO2-dlx3b + MO4-dlx4b standard conditions Fig. 5 with image from Solomon et al., 2002
otic placode pax2a expression absent, abnormal WT + MO2-dlx3b + MO4-dlx4b standard conditions Fig. 6 with image from Sun et al., 2007
otic vesicle development process quality, abnormal WT + MO2-dlx3b + MO4-dlx4b standard conditions Fig. 4 with image from Solomon et al., 2002
otic vesicle decreased size, abnormal WT + MO2-dlx3b + MO4-dlx4b standard conditions Fig. 2 with image from Solomon et al., 2002
olfactory placode development process quality, abnormal WT + MO2-dlx3b + MO4-dlx4b standard conditions Fig. 4 with image from Solomon et al., 2002
otic vesicle development process quality, abnormal WT + MO2-dlx3b + MO5-dlx4b standard conditions Fig. 4 with image from Solomon et al., 2002
olfactory placode development process quality, abnormal WT + MO2-dlx3b + MO5-dlx4b standard conditions Fig. 4 with image from Solomon et al., 2002
otolith absent, abnormal WT + MO2-dlx3b + MO5-dlx4b standard conditions Fig. 2 with image from Solomon et al., 2002
olfactory placode formation arrested, abnormal WT + MO2-dlx3b + MO5-dlx4b standard conditions Fig. 5 with image from Solomon et al., 2002
otic vesicle decreased size, abnormal WT + MO2-dlx3b + MO5-dlx4b standard conditions Fig. 2 with image from Solomon et al., 2002
otic vesicle decreased size, abnormal WT + MO2-dlx3b + MO6-pax8 + MO7-pax8 standard conditions Fig. 8 with image from Mackereth et al., 2005
otic vesicle lacks all parts of type hair cell, abnormal WT + MO2-dlx3b + MO6-pax8 + MO7-pax8 standard conditions Fig. 8 with image from Mackereth et al., 2005
otic vesicle lacks all parts of type otolith, abnormal WT + MO2-dlx3b + MO6-pax8 + MO7-pax8 standard conditions Fig. 8 with image from Mackereth et al., 2005
otic vesicle morphogenesis process quality, abnormal WT + MO2-dlx3b + MO6-pax8 + MO7-pax8 standard conditions Fig. 8 with image from Mackereth et al., 2005
Genome Resources:
CITATIONS (6)