Morpholino

MO1-gata2a

ID
ZDB-MRPHLNO-050208-12
Name
MO1-gata2a
Previous Names
  • MO gata2 (1)
  • MO(S)-gata2 (1)
  • MO1-gata2 (1)
Target
Sequence
5' - CATCTACTCACCAGTCTGCGCTTTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
A splice blocking morpholino targeting the third exon/intron boundary of gata2.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gata2a
Expressed Gene Anatomy Figures
alas2 Fig. 3 with image from Galloway et al., 2005
bmp4 Fig. 2 with image from Vermot et al., 2009
cahz Fig. 3 with image from Galloway et al., 2005
edn1 Fig. 2 with image from Vermot et al., 2009
gad1b Fig. 9 with image from Yang et al., 2010
gata1a Fig. 3 with image,  Fig. 4 with image from Galloway et al., 2005
glcci1a Fig. 4 with image from Galloway et al., 2005
hbbe1.1 Fig. 3 with image from Galloway et al., 2005
ikzf1 Fig. 1 with image from Galloway et al., 2005
klf2a Fig. 2 with image from Vermot et al., 2009
klf17 Fig. 4 with image from Galloway et al., 2005
krcp Fig. 4 with image from Galloway et al., 2005
lcp1 Fig. 1 with image from Galloway et al., 2005
mpx Fig. 1 with image from Galloway et al., 2005
myb Fig. 1 with image from Galloway et al., 2005
notch1b Fig. 2 with image from Vermot et al., 2009
nrg1 Fig. 2 with image from Vermot et al., 2009
runx1 Fig. 1 with image from Galloway et al., 2005
smchd1 Fig. 4 with image from Galloway et al., 2005
spi1b Fig. 1 with image from Galloway et al., 2005
tal2 Fig. 9 with image from Yang et al., 2010
Phenotype
Phenotype resulting from MO1-gata2a
Phenotype Fish Figures
atrial endocardium endothelial cell decreased amount, abnormal ubs10Tg + MO1-gata2a Fig. 2 with image from Heckel et al., 2015
atrioventricular canal ab2-fn labeling decreased amount, abnormal ubs10Tg + MO1-gata2a Fig. 5 with image from Steed et al., 2016
atrioventricular canal GCaMP expression decreased amount, abnormal ubs3Tg; zf350Tg + MO1-gata2a Fig. 4 with image from Heckel et al., 2015
atrioventricular canal EGFP expression decreased amount, abnormal ig11Tg + MO1-gata2a Fig. 2 with image from Heckel et al., 2015
atrioventricular canal blood circulation process quality, abnormal sd2Tg + MO1-gata2a Fig. 2 with image from Heckel et al., 2015
atrioventricular valve absent, abnormal WT + MO1-gata2a Fig. 2 with image from Vermot et al., 2009
atrioventricular valve morphology, abnormal WT + MO1-gata2a Fig. 2 with image from Vermot et al., 2009
atrioventricular valve formation disrupted, abnormal WT + MO1-gata2a Fig. 2 with image from Vermot et al., 2009
blood accumulation trunk vasculature, abnormal s843Tg + MO1-gata2a Fig. 5 from Fiedler et al., 2011
blood decreased viscosity, abnormal WT + MO1-gata2a Fig. 2 with image from Vermot et al., 2009
blood circulating cell decreased amount, abnormal WT + MO1-gata2a Fig. 2 with image from Vermot et al., 2009
endocardial cushion cell decreased amount, abnormal s843Tg + MO1-gata2a Fig. 5 with image from Vermot et al., 2009
intersegmental vein decreased length, abnormal s843Tg + MO1-gata2a Fig. 5 from Fiedler et al., 2011
lateral floor plate Kolmer-Agduhr neuron undifferentiated, abnormal WT + MO1-gata2a Fig. 9 with image from Yang et al., 2010
pericardium edematous, abnormal s843Tg + MO1-gata2a Fig. 5 from Fiedler et al., 2011
ventral spinal cord interneuron differentiation disrupted, abnormal WT + MO1-gata2a Fig. 9 with image from Yang et al., 2010
Phenotype of all Fish created by or utilizing MO1-gata2a
Phenotype Fish Conditions Figures
blood circulating cell decreased amount, abnormal WT + MO1-gata2a standard conditions Fig. 2 with image from Vermot et al., 2009
atrioventricular valve absent, abnormal WT + MO1-gata2a standard conditions Fig. 2 with image from Vermot et al., 2009
ventral spinal cord interneuron differentiation disrupted, abnormal WT + MO1-gata2a standard conditions Fig. 9 with image from Yang et al., 2010
atrioventricular valve morphology, abnormal WT + MO1-gata2a standard conditions Fig. 2 with image from Vermot et al., 2009
lateral floor plate Kolmer-Agduhr neuron undifferentiated, abnormal WT + MO1-gata2a standard conditions Fig. 9 with image from Yang et al., 2010
blood decreased viscosity, abnormal WT + MO1-gata2a standard conditions Fig. 2 with image from Vermot et al., 2009
atrioventricular valve formation disrupted, abnormal WT + MO1-gata2a standard conditions Fig. 2 with image from Vermot et al., 2009
atrioventricular canal EGFP expression decreased amount, abnormal ig11Tg + MO1-gata2a control Fig. 2 with image from Heckel et al., 2015
pericardium edematous, abnormal s843Tg + MO1-gata2a standard conditions Fig. 5 from Fiedler et al., 2011
endocardial cushion cell decreased amount, abnormal s843Tg + MO1-gata2a standard conditions Fig. 5 with image from Vermot et al., 2009
intersegmental vein decreased length, abnormal s843Tg + MO1-gata2a standard conditions Fig. 5 from Fiedler et al., 2011
blood accumulation trunk vasculature, abnormal s843Tg + MO1-gata2a standard conditions Fig. 5 from Fiedler et al., 2011
atrioventricular canal blood circulation process quality, abnormal sd2Tg + MO1-gata2a control Fig. 2 with image from Heckel et al., 2015
atrial endocardium endothelial cell decreased amount, abnormal ubs10Tg + MO1-gata2a control Fig. 2 with image from Heckel et al., 2015
atrioventricular canal ab2-fn labeling decreased amount, abnormal ubs10Tg + MO1-gata2a control Fig. 5 with image from Steed et al., 2016
atrioventricular canal GCaMP expression decreased amount, abnormal ubs3Tg; zf350Tg + MO1-gata2a control Fig. 4 with image from Heckel et al., 2015
atrioventricular canal GCaMP expression amount, ameliorated ubs3Tg; zf350Tg + MO1-gata2a chemical treatment: 4alpha-phorbol 12,13-didecanoate Fig. 4 with image from Heckel et al., 2015
primitive hemopoiesis disrupted, abnormal gata1am651/m651 + MO1-gata2a standard conditions Fig. 7 from Belele et al., 2009
spinal cord sox1a expression decreased distribution, abnormal ABO + MO1-gata2a + MO1-gata3 standard conditions Fig. 5 with image from Gerber et al., 2019
spinal cord sox1b expression decreased distribution, abnormal ABO + MO1-gata2a + MO1-gata3 standard conditions Fig. 5 with image from Gerber et al., 2019
spinal cord gad1b expression decreased distribution, abnormal ABO + MO1-gata2a + MO1-gata3 standard conditions Fig. 5 with image from Gerber et al., 2019
atrioventricular valve morphology, abnormal WT + MO1-gata1a + MO1-gata2a standard conditions Fig. 2 with image from Vermot et al., 2009
blood decreased viscosity, abnormal WT + MO1-gata1a + MO1-gata2a standard conditions Fig. 2 with image from Vermot et al., 2009
blood circulating cell absent, abnormal WT + MO1-gata1a + MO1-gata2a standard conditions Fig. 2 with image from Vermot et al., 2009
atrioventricular canal EGFP expression decreased amount, abnormal ig11Tg + MO1-gata1a + MO1-gata2a control Fig. 2 with image from Heckel et al., 2015
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.