Morpholino
MO1-gata2a
- ID
- ZDB-MRPHLNO-050208-12
- Name
- MO1-gata2a
- Previous Names
- Target
- Sequence
-
5' - CATCTACTCACCAGTCTGCGCTTTG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
A splice blocking morpholino targeting the third exon/intron boundary of gata2.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-gata2a
Expressed Gene | Anatomy | Figures |
---|---|---|
alas2 |
Fig. 3 ![]() |
|
bmp4 |
Fig. 2 ![]() |
|
cahz |
Fig. 3 ![]() |
|
edn1 |
Fig. 2 ![]() |
|
gad1b |
Fig. 9 ![]() |
1 - 5 of 21 Show all
Phenotype
Phenotype resulting from MO1-gata2a
1 - 5 of 16 Show all
Phenotype of all Fish created by or utilizing MO1-gata2a
1 - 5 of 25 Show all
Citations
- Wang, R., Guo, S., Yang, L. (2022) Tal2 is required for generation of GABAergic neurons in the zebrafish midbrain. Developmental Dynamics : an official publication of the American Association of Anatomists. 252(2):263-275
- Gerber, V., Yang, L., Takamiya, M., Ribes, V., Gourain, V., Peravali, R., Stegmaier, J., Mikut, R., Reischl, M., Ferg, M., Rastegar, S., Strähle, U. (2019) The HMG box transcription factors Sox1a and b specify a new class of glycinergic interneurons in the spinal cord of zebrafish embryos. Development (Cambridge, England). 146(4):
- Lombardo, V.A., Heise, M., Moghtadaei, M., Bornhorst, D., Männer, J., Abdelilah-Seyfried, S. (2019) Morphogenetic control of zebrafish cardiac looping by Bmp signaling. Development (Cambridge, England). 146(22):
- Becker, P.W., Sacilotto, N., Nornes, S., Neal, A., Thomas, M., Liu, K., Preece, C., Ratnayaka, I., Davies, B., Bou-Gharios, G., De Val, S. (2016) Intronic Flk1 Enhancer Directs Arterial-Specific Expression via RBPJ-Mediated Venous Repression. Arteriosclerosis, Thrombosis, and Vascular Biology. 36(6):1209-19
- Steed, E., Faggianelli, N., Roth, S., Ramspacher, C., Concordet, J.P., Vermot, J. (2016) klf2a couples mechanotransduction and zebrafish valve morphogenesis through fibronectin synthesis. Nature communications. 7:11646
- Heckel, E., Boselli, F., Roth, S., Krudewig, A., Belting, H. G., Charvin, G., Vermot, J. (2015) Oscillatory Flow Modulates Mechanosensitive klf2a Expression through trpv4 and trpp2 during Heart Valve Development. Current biology : CB. 25(10):1354-1361
- Samsa, L.A., Givens, C., Tzima, E., Stainier, D.Y., Qian, L., Liu, J. (2015) Cardiac contraction activates endocardial Notch signaling to modulate chamber maturation in zebrafish. Development (Cambridge, England). 142:4080-91
- Dietrich, A.C., Lombardo, V.A., Abdelilah-Seyfried, S. (2014) Blood Flow and Bmp Signaling Control Endocardial Chamber Morphogenesis. Developmental Cell. 30:367-377
- Banjo, T., Grajcarek, J., Yoshino, D., Osada, H., Miyasaka, K.Y., Kida, Y.S., Ueki, Y., Nagayama, K., Kawakami, K., Matsumoto, T., Sato, M., and Ogura, T. (2013) Haemodynamically dependent valvulogenesis of zebrafish heart is mediated by flow-dependent expression of miR-21. Nature communications. 4:1978
- Liu, F., Bhang, S.H., Arentson, E., Sawada, A., Kim, C.K., Kang, I., Yu, J., Sakurai, N., Kim, S.H., Yoo, J.J., Kim, P., Pahng, S.H., Xia, Y., Solnica-Krezel, L., and Choi, K. (2013) Enhanced hemangioblast generation and improved vascular repair and regeneration from embryonic stem cells by defined transcription factors. Stem Cell Reports. 1(2):166-182
1 - 10 of 18
Show