Morpholino

MO1-shha

ID
ZDB-MRPHLNO-050204-6
Name
MO1-shha
Previous Names
  • MO(T)-shh
  • MO1-shh (1)
  • shh-MO (2)
Target
Sequence
5' - CAGCACTCTCGTCAAAAGCCGCATT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
A translation blocking morpholino against shh. Embryos have a normal head and u-shaped somites. The myoseptum is absent. The finbuds are reduced compared with wild type embryos.
Genome Resources
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-shha
Expressed Gene Anatomy Figures
egr2b Fig. 4 from Zhang et al., 2017
en2b Fig. 8 from Zhang et al., 2017
epha4a Fig. 3 from Zhang et al., 2017
fgf8a Fig. 6 from Zhang et al., 2017
gad1b Fig. S2 from Zhang et al., 2014
glis3 Fig. 5 from Rurale et al., 2019
otx2b Fig. 1 from Zhang et al., 2017
pax2a Fig. 5 from Zhang et al., 2017
pax6a Fig. 2 from Zhang et al., 2017
Fig. S2 from Zhang et al., 2014
prox1a Fig. 6 from Philipp et al., 2008
ptch2 Fig. 6 from Philipp et al., 2008
wnt1 Fig. 7 from Zhang et al., 2017
Phenotype
Phenotype resulting from MO1-shha
Phenotype Fish Figures
brain glis3 expression absent, abnormal AB + MO1-shha Fig. 5 from Rurale et al., 2019
endoderm glis3 expression absent, abnormal AB + MO1-shha Fig. 5 from Rurale et al., 2019
eye pax6a expression decreased amount, abnormal AB + MO1-shha Fig. 2 from Zhang et al., 2017
forebrain pax6a expression decreased amount, abnormal AB + MO1-shha Fig. 2 from Zhang et al., 2017
hindbrain pax6a expression decreased amount, abnormal AB + MO1-shha Fig. 2 from Zhang et al., 2017
midbrain hindbrain boundary morphology, abnormal AB + MO1-shha Fig. 5 from Zhang et al., 2017
odontogenesis arrested, abnormal WT + MO1-shha Fig. 3 with image from Jackman et al., 2010
pancreas primordium Ab8-ins labeling decreased amount, abnormal AB + MO1-shha Fig. 5 with image from Yang et al., 2021
pancreas primordium ab2-isl labeling decreased amount, abnormal AB + MO1-shha Fig. 5 with image from Yang et al., 2021
slow muscle cell nucleus decreased amount, abnormal WT + MO1-shha Fig. 6 from Philipp et al., 2008
somite muscle pioneer decreased amount, abnormal WT + MO1-shha Fig. 6 from Philipp et al., 2008
whole organism lacks all parts of type ceratobranchial 5 tooth, abnormal WT + MO1-shha Fig. 3 with image from Jackman et al., 2010
Phenotype of all Fish created by or utilizing MO1-shha
Phenotype Fish Conditions Figures
midbrain hindbrain boundary present, ameliorated AB + MO1-shha chemical treatment: ethanol, chemical treatment: retinoic acid Fig. 1 from Zhang et al., 2015
pancreas primordium ab2-isl labeling decreased amount, abnormal AB + MO1-shha standard conditions Fig. 5 with image from Yang et al., 2021
swimming behavior process quality, abnormal AB + MO1-shha chemical treatment by environment: ethanol Fig. 4,  Fig. 5 from Burton et al., 2017
swimming behavior disrupted, abnormal AB + MO1-shha chemical treatment by environment: ethanol Fig. 7,  Fig. 8 from Boa-Amponsem et al., 2020
midbrain hindbrain boundary absent, abnormal AB + MO1-shha chemical treatment: ethanol Fig. 1 from Zhang et al., 2015
hindbrain pax6a expression decreased amount, abnormal AB + MO1-shha standard conditions Fig. 2 from Zhang et al., 2017
pancreas primordium Ab8-ins labeling decreased amount, abnormal AB + MO1-shha standard conditions Fig. 5 with image from Yang et al., 2021
eye decreased size, abnormal AB + MO1-shha chemical treatment by environment: ethanol Fig. 2,  Fig. 3 from Boa-Amponsem et al., 2020
endoderm glis3 expression absent, abnormal AB + MO1-shha control Fig. 5 from Rurale et al., 2019
forebrain pax6a expression decreased amount, abnormal AB + MO1-shha standard conditions Fig. 2 from Zhang et al., 2017
eye decreased size, abnormal AB + MO1-shha chemical treatment: ethanol Fig. 6 from Zhang et al., 2015
midbrain hindbrain boundary morphology, abnormal AB + MO1-shha standard conditions Fig. 5 from Zhang et al., 2017
eye decreased size, abnormal AB + MO1-shha chemical treatment: ethanol, chemical treatment: retinoic acid Fig. 6 from Zhang et al., 2015
brain glis3 expression absent, abnormal AB + MO1-shha control Fig. 5 from Rurale et al., 2019
eye pax6a expression decreased amount, abnormal AB + MO1-shha standard conditions Fig. 2 from Zhang et al., 2017
midbrain hindbrain boundary malformed, abnormal AB + MO1-shha chemical treatment by environment: ethanol Fig. 2 from Burton et al., 2017
eye decreased size, abnormal AB + MO1-shha chemical treatment by environment: ethanol Fig. 3 from Burton et al., 2017
slow muscle cell nucleus decreased amount, abnormal WT + MO1-shha standard conditions Fig. 6 from Philipp et al., 2008
whole organism lacks all parts of type ceratobranchial 5 tooth, abnormal WT + MO1-shha standard conditions Fig. 3 with image from Jackman et al., 2010
somite muscle pioneer decreased amount, abnormal WT + MO1-shha standard conditions Fig. 6 from Philipp et al., 2008
odontogenesis arrested, abnormal WT + MO1-shha standard conditions Fig. 3 with image from Jackman et al., 2010
midbrain-hindbrain boundary development process quality, abnormal WT + MO1-shha chemical treatment: ethanol Fig. 10,  Fig. S1 from Zhang et al., 2014
eye decreased size, abnormal WT + MO1-shha chemical treatment: ethanol Fig. S1 from Zhang et al., 2014
pancreas primordium Ab8-ins labeling amount, ameliorated cq109Tg/cq109Tg + MO1-shha standard conditions Fig. 5 with image from Yang et al., 2021
pancreas primordium ab2-isl labeling amount, ameliorated cq109Tg/cq109Tg + MO1-shha standard conditions Fig. 5 with image from Yang et al., 2021
midbrain hindbrain boundary absent, abnormal AB + MO1-aldh1a3 + MO1-shha control Fig. 1 from Zhang et al., 2015
midbrain hindbrain boundary present, ameliorated AB + MO1-aldh1a3 + MO1-shha chemical treatment: retinoic acid Fig. 1 from Zhang et al., 2015
pancreas primordium Ab8-ins labeling amount, ameliorated AB + MO1-shha + MO2-gmnn standard conditions Fig. 5 with image from Yang et al., 2021
pancreas primordium ab2-isl labeling amount, ameliorated AB + MO1-shha + MO2-gmnn standard conditions Fig. 5 with image from Yang et al., 2021
slow muscle cell nucleus decreased amount, abnormal WT + MO1-grk3 + MO1-shha standard conditions Fig. 6 from Philipp et al., 2008
somite muscle pioneer decreased amount, abnormal WT + MO1-grk3 + MO1-shha standard conditions Fig. 6 from Philipp et al., 2008
odontogenesis delayed, abnormal WT + MO1-shha + MO2-shhb standard conditions Fig. 3 with image from Jackman et al., 2010
tooth placode position, abnormal WT + MO1-shha + MO2-shhb standard conditions Fig. 3 with image from Jackman et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.