Morpholino

MO1-tp53

ID
ZDB-MRPHLNO-050107-3
Name
MO1-tp53
Previous Names
  • MO p53 (1)
  • MO1-p53
Target
Sequence
5' - AGAATTGATTTTGCCGACCTCCTCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-tp53
No data available
Phenotype
Phenotype resulting from MO1-tp53
Phenotype of all Fish created by or utilizing MO1-tp53
Phenotype Fish Conditions Figures
pronephros lacks all parts of type corpuscles of Stannius, abnormal TU + MO1-sim1a + MO1-tp53 standard conditions Fig. S6 with image from Cheng et al., 2015
pronephric proximal convoluted tubule distended, abnormal TU + MO1-sim1a + MO1-tp53 standard conditions Fig. S6 with image from Cheng et al., 2015
pronephros lacks all parts of type pronephric proximal straight tubule, abnormal TU + MO1-sim1a + MO1-tp53 standard conditions Fig. S6 with image from Cheng et al., 2015
pronephric proximal tubule development decreased process quality, abnormal TU + MO1-sim1a + MO1-tp53 standard conditions Fig. S6 with image from Cheng et al., 2015
pronephric distal early tubule mislocalised posteriorly, abnormal TU + MO1-tp53 standard conditions Fig. S6 with image from Cheng et al., 2015
pronephric proximal convoluted tubule distended, abnormal TU + MO1-tp53 standard conditions Fig. S6 with image from Cheng et al., 2015
pronephric proximal straight tubule mislocalised posteriorly, abnormal TU + MO1-tp53 standard conditions Fig. S6 with image from Cheng et al., 2015
retinal ganglion cell layer morphology, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 4 from Diekmann et al., 2009
retinal ganglion cell decreased amount, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 4,  Fig. 6 from Diekmann et al., 2009
eye mislocalised ventrally, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 3 from Diekmann et al., 2009
eye decreased size, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 3,  Fig. 4,  Fig. S2 from Diekmann et al., 2009
integument melanocyte decreased contractility, abnormal WT + MO1-alcama + MO1-tp53 high light intensity Fig. 3 from Diekmann et al., 2009
ventral mandibular arch decreased size, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 3 from Diekmann et al., 2009
integument melanocyte spatial pattern, abnormal WT + MO1-alcama + MO1-tp53 high light intensity Fig. 3 from Diekmann et al., 2009
retinal neural layer nucleus apoptotic, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 4 from Diekmann et al., 2009
optic nerve head axon absent, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 4 from Diekmann et al., 2009
pericardial cavity increased size, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 3 from Diekmann et al., 2009
retina morphogenesis in camera-type eye disrupted, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 6 from Diekmann et al., 2009
whole organism decreased size, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 3 from Diekmann et al., 2009
retinal inner nuclear layer neuron decreased amount, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 4 from Diekmann et al., 2009
neuron differentiation arrested, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 6 from Diekmann et al., 2009
cranial nerve II aplastic, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 5 from Diekmann et al., 2009
neuron differentiation decreased rate, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 6 from Diekmann et al., 2009
cranial nerve II decreased thickness, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 5 from Diekmann et al., 2009
optic nerve head decreased size, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 4 from Diekmann et al., 2009
eye decreased diameter, abnormal WT + MO1-alcama + MO1-tp53 standard conditions Fig. 4 from Diekmann et al., 2009
forebrain apoptotic, abnormal WT + MO1-appl1 + MO1-tp53 standard conditions Fig. S4 with image from Schenck et al., 2008
neural crest cell migration disrupted, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 2 with image from Tuttle et al., 2014
post-vent region decreased length, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 2 with image,  Fig. S1 with image from Tuttle et al., 2014
post-vent region curved, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. S1 with image from Tuttle et al., 2014
melanocyte decreased amount, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. S1 with image from Tuttle et al., 2014
post-vent region kinked, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 2 with image from Tuttle et al., 2014
midbrain hindbrain boundary morphology, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 2 with image from Tuttle et al., 2014
pericardium edematous, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. S1 with image from Tuttle et al., 2014
xanthoblast neural crest cell aggregated, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 2 with image from Tuttle et al., 2014
canonical Wnt signaling pathway decreased process quality, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 5 with image from Tuttle et al., 2014
melanoblast neural crest cell aggregated, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 2 with image from Tuttle et al., 2014
neural crest cell migration decreased rate, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. S5 with image from Tuttle et al., 2014
neural crest cell mislocalised, abnormal WT + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 2 with image from Tuttle et al., 2014
apoptotic process increased occurrence, abnormal WT + MO1-plrg1 + MO1-tp53 standard conditions Fig. 9 from Kleinridders et al., 2009
whole organism apoptotic, abnormal WT + MO1-plrg1 + MO1-tp53 standard conditions Fig. 9 from Kleinridders et al., 2009
somite border muscle tendon junction morphology, abnormal WT + MO1-thbs4b + MO1-tp53 mechanical stress Fig. 2 with image from Subramanian et al., 2014
muscle detached from tendon, abnormal WT + MO1-thbs4b + MO1-tp53 standard conditions Fig. 4 with image from Subramanian et al., 2014
somite border muscle tendon junction morphology, abnormal WT + MO1-thbs4b + MO1-tp53 standard conditions Fig. 4 with image,  Fig. 5 with image from Subramanian et al., 2014
muscle detached from tendon, abnormal WT + MO1-thbs4b + MO1-tp53 mechanical stress Fig. 2 with image from Subramanian et al., 2014
neural crest cell aggregated, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. S2 with image,  Fig. S3 with image from Tuttle et al., 2014
neural crest cell endosome immature, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 3 with image from Tuttle et al., 2014
neural crest cell migration decreased rate, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 2 with image from Tuttle et al., 2014
neural crest cell migration process quality, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 2 with image from Tuttle et al., 2014
neural crest cell early endosome aggregated, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 3 with image from Tuttle et al., 2014
neural crest cell late endosome decreased size, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 3 with image from Tuttle et al., 2014
neural crest cell early endosome increased size, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 3 with image,  Fig. S6 with image from Tuttle et al., 2014
neural crest cell mislocalised, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. S2 with image,  Fig. S3 with image from Tuttle et al., 2014
neural crest cell late endosome decreased amount, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 3 with image from Tuttle et al., 2014
neural crest cell endocytosis process quality, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 3 with image from Tuttle et al., 2014
neural crest cell early endosome increased amount, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 3 with image,  Fig. S6 with image from Tuttle et al., 2014
neural crest cell migration disrupted, abnormal ir937Tg + MO1-dmxl2 + MO1-tp53 standard conditions Fig. 2 with image,  Fig. S2 with image,  Fig. S3 with image from Tuttle et al., 2014
neural crest cell early endosome increased amount, abnormal ir937Tg + MO1-tp53 + MO2-atp6v0a1a standard conditions Fig. 4 with image from Tuttle et al., 2014
neural crest cell endosome immature, abnormal ir937Tg + MO1-tp53 + MO2-atp6v0a1a standard conditions Fig. 4 with image from Tuttle et al., 2014
neural crest cell migration process quality, abnormal ir937Tg + MO1-tp53 + MO2-atp6v0a1a standard conditions Fig. 4 with image from Tuttle et al., 2014
neural crest cell migration disrupted, abnormal ir937Tg + MO1-tp53 + MO2-atp6v0a1a standard conditions Fig. 4 with image from Tuttle et al., 2014
neural crest cell migration decreased rate, abnormal ir937Tg + MO1-tp53 + MO2-atp6v0a1a standard conditions Fig. 4 with image from Tuttle et al., 2014
neural crest cell aggregated, abnormal ir937Tg + MO1-tp53 + MO2-dmxl2 standard conditions Fig. S3 with image from Tuttle et al., 2014
neural crest cell migration disrupted, abnormal ir937Tg + MO1-tp53 + MO2-dmxl2 standard conditions Fig. S3 with image from Tuttle et al., 2014
neural crest cell mislocalised, abnormal ir937Tg + MO1-tp53 + MO2-dmxl2 standard conditions Fig. S3 with image from Tuttle et al., 2014
cranial nerve II aplastic, abnormal s356tTg + MO1-alcama + MO1-tp53 standard conditions Fig. 7 from Diekmann et al., 2009
retinal rod cell differentiation process quality, abnormal s356tTg + MO1-alcama + MO1-tp53 standard conditions Fig. 7 from Diekmann et al., 2009
retinal ganglion cell decreased amount, abnormal s356tTg + MO1-alcama + MO1-tp53 standard conditions Fig. 7 from Diekmann et al., 2009
amacrine cell decreased amount, abnormal s356tTg + MO1-alcama + MO1-tp53 standard conditions Fig. 7 from Diekmann et al., 2009
cranial nerve II decreased thickness, abnormal s356tTg + MO1-alcama + MO1-tp53 standard conditions Fig. 7 from Diekmann et al., 2009
retina morphogenesis in camera-type eye disrupted, abnormal s356tTg + MO1-alcama + MO1-tp53 standard conditions Fig. 7 from Diekmann et al., 2009
retinal rod cell differentiation delayed, abnormal s356tTg + MO1-alcama + MO1-tp53 standard conditions Fig. 7 from Diekmann et al., 2009
neuron differentiation arrested, abnormal s356tTg + MO1-alcama + MO1-tp53 standard conditions Fig. 7 from Diekmann et al., 2009
muscle detached from tendon, abnormal ilkhu801/hu801 + MO1-thbs4b + MO1-tp53 mechanical stress Fig. 4 with image from Subramanian et al., 2014
median fin fold degeneration, ameliorated mtm1zf711/zf711 + MO1-hdac1 + MO1-tp53 standard conditions Fig. 1 with image from Volpatti et al., 2022
median fin fold degenerate, abnormal mtm1zf711/zf711 + MO1-hdac3 + MO1-tp53 standard conditions Fig. 1 with image from Volpatti et al., 2022
median fin fold degenerate, exacerbated mtm1zf711/zf711 + MO1-hdac6 + MO1-tp53 standard conditions Fig. 1 with image from Volpatti et al., 2022
median fin fold degenerate, exacerbated mtm1zf711/zf711 + MO1-hdac8 + MO1-tp53 standard conditions Fig. 1 with image from Volpatti et al., 2022
T cell differentiation in thymus disrupted, abnormal top3at22406/t22406 + MO1-tp53 (TU) standard conditions Fig. 3 from Mönnich et al., 2010
pharyngeal arch 5 immature, abnormal WT + MO1-rarga + MO1-rargb + MO1-tp53 standard conditions Fig. 4 with image from Linville et al., 2009
Citations