FIGURE

Fig. 6

ID
ZDB-FIG-210518-84
Publication
Sheets et al., 2021 - How Zebrafish Can Drive the Future of Genetic-based Hearing and Balance Research
Other Figures
All Figure Page
Back to All Figure Page
Fig. 6

Two examples G0slc17a8 CRISPant analysis and genotyping. Neuromasts from uninjected a and CRISPants embryos injected with the following gRNAs directed against the following sites in exon 2 of slc17a8 (5′-3′): GACAGAAGATGGTCGGCCGG (TGG), GGTGCTTTGGCCTTCCCAAA (CGG), and GCCCACCCCTATTGGACTGT (GGG) along with Cas9 protein bc. Staining with anti-Slc17a8 (Obholzer et al. 2008) and anti-MyosinVIIA (Developmental Studies Hybridoma Bank, #138-1) to label lateral line hair cells reveal that Slc17a8 staining is absent in G0 CRISPants that lack an acoustic startle response. Schematic of PCR analysis of slc17a8 d used to detect INDELs. The CRISPR-STAT assay, relying on fluorescent fragment analysis can be used to genotype individual CRISPants larvae and test gRNA efficiency. In these examples, there is a single peak in control larvae at 310 bp e. By comparison, in G0slc17a8 CRISPants the peak at 310 bp is degraded, and numerous fragments (indicative of the many INDELs present in this mosaic founder) surrounding this peak are present f. Schematic of PCR analysis of slc17a8g used to detect a large deletion. This PCR analysis was conducted on genomic DNA from uninjected control and CRISPant larvae lacking a startle response. Primers flank the sites targeted by the guides targeting exon 2 ((5′-3′)CACAGTCTACATCAACGGGA(CGG)) and exon 12 (TCCAGTGTAATGCACCATGG(AGG)) and were used to amplify the region between exon 2 and exon 12. Deletion of a 14.2-kb region in CRISPants yielded an ~ 400-bp PR product (lanes 1–6, i) that was absent in uninjected controls (lanes 1–6, h). Images in ac were taken at × 63 magnification on a Zeiss LSM 780 confocal microscope. Scale bar in c = 5 µm

Expression Data

Expression Detail
Antibody Labeling
Phenotype Data

Phenotype Detail
Acknowledgments
This image is the copyrighted work of the attributed author or publisher, and ZFIN has permission only to display this image to its users. Additional permissions should be obtained from the applicable author or publisher of the image. Full text @ J. Assoc. Res. Otolaryngol.