Fig. 2
- ID
- ZDB-FIG-071204-12
- Publication
- Walker et al., 2007 - phospholipase C, beta 3 is required for Endothelin1 regulation of pharyngeal arch patterning in zebrafish
- Other Figures
- (all 10)
- All Figure Page
- Back to All Figure Page
Segregation and sequence analysis of two plcβ3 alleles and plcβ3 MO splice variant. (A) schmerle (plcβ3) maps to Danio rerio chromosome 7 between microsatellites Z7958 and Z8540. (B) Schematic of protein domains in plcβ3+(wt) and lesions in plcβ3tg203e and plcβ3th210. Sequence around lesion sites is aligned with other vertebrate Plcβ3 and with Plc in fly. Dots indicate sequence identity. Abbreviations: PH (pleckstrin homology), EF (EF hand), C2 (protein kinase C conserved region 2). (C) Sequence chromatograms of plcβ3tg203eand plcβ3th210 around lesion sites in plcβ3. In plcβ3tg203e a T-to-C mutation results in the transformation of a conserved serine to a phenylalanine in the X domain of the catalytic domain. In plcβ3th210 a C-to-T mutation results in the transformation of a conserved leucine to proline in the Y domain of the catalytic domain. (D) RT-PCR analysis of plcβ3 mRNA structure in wild-type and splice MO-injected embryos. plcβ3 splice-blocking MO is complementary to exon 4 splice donor site. Primers designed to exon1 and exon5 were used in RT-PCR of uninjected and plcβ3 splice-blocking MO injected embryos at 1 dpf (5′CCGTTGTTACACTGAAGGT3′/5′GCTTTGAGTAAGAAGGTGTTG3′). (E) cDNA sequence comparison reveals that plcβ3 splice-blocking MO variant results from aberrant splicing to a cryptic splice site locate 51 bases 5′ of the normal exon4 splice donor. The plcβ3 MO splice variant results in the deletion of 17 amino acids within the PH domain of plcβ3. |
Gene: | |
---|---|
Fish: | |
Knockdown Reagent: | |
Anatomical Term: | |
Stage: | Prim-5 |
Reprinted from Developmental Biology, 304(1), Walker, M.B., Miller, C.T., Swartz, M.E., Eberhart, J.K., and Kimmel, C.B., phospholipase C, beta 3 is required for Endothelin1 regulation of pharyngeal arch patterning in zebrafish, 194-207, Copyright (2007) with permission from Elsevier. Full text @ Dev. Biol.