Morpholino

MO1-plcb3

ID
ZDB-MRPHLNO-080225-4
Name
MO1-plcb3
Previous Names
None
Target
Sequence
5' - TTGTCGTGGTTACCTTGCAATAGCC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice blocking.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-plcb3
No data available
Phenotype
Phenotype resulting from MO1-plcb3
Phenotype of all Fish created by or utilizing MO1-plcb3
Phenotype Fish Conditions Figures
hyosymplectic cartilage decreased size, abnormal plcb3th210/th210 + MO1-plcb3 (AB) standard conditions Fig. 3 with image from Walker et al., 2007
branchiostegal ray 3 shape, abnormal plcb3th210/th210 + MO1-plcb3 (AB) standard conditions Fig. 3 with image from Walker et al., 2007
cartilage element mislocalised, abnormal plcb3th210/th210 + MO1-plcb3 (AB) standard conditions Fig. 3 with image from Walker et al., 2007
opercle shape, abnormal plcb3th210/th210 + MO1-plcb3 (AB) standard conditions Fig. 3 with image from Walker et al., 2007
cartilage element mislocalised, abnormal AB + MO1-plcb3 standard conditions Fig. 3 with image from Walker et al., 2007
opercle shape, abnormal AB + MO1-plcb3 standard conditions Fig. 3 with image from Walker et al., 2007
branchiostegal ray 3 shape, abnormal AB + MO1-plcb3 standard conditions Fig. 3 with image from Walker et al., 2007
hyosymplectic cartilage decreased size, abnormal AB + MO1-plcb3 standard conditions Fig. 3 with image from Walker et al., 2007
opercle shape, abnormal AB + MO1-plcb3 + MO2-plcb3 standard conditions text only from Walker et al., 2007
cartilage element mislocalised, abnormal AB + MO1-plcb3 + MO2-plcb3 standard conditions text only from Walker et al., 2007
branchiostegal ray 3 shape, abnormal AB + MO1-plcb3 + MO2-plcb3 standard conditions text only from Walker et al., 2007
hyosymplectic cartilage decreased size, abnormal AB + MO1-plcb3 + MO2-plcb3 standard conditions text only from Walker et al., 2007
cartilage element mislocalised, abnormal edn1tf216b/+ + MO1-plcb3 + MO2-plcb3 (AB) standard conditions text only from Walker et al., 2007
opercle shape, abnormal edn1tf216b/+ + MO1-plcb3 + MO2-plcb3 (AB) standard conditions text only from Walker et al., 2007
hyosymplectic cartilage decreased size, abnormal edn1tf216b/+ + MO1-plcb3 + MO2-plcb3 (AB) standard conditions text only from Walker et al., 2007
branchiostegal ray 3 shape, abnormal edn1tf216b/+ + MO1-plcb3 + MO2-plcb3 (AB) standard conditions text only from Walker et al., 2007
cartilage element mislocalised, abnormal edn1tf216b/+; plcb3th210/+ + MO1-plcb3 + MO2-plcb3 (AB) standard conditions text only from Walker et al., 2007
hyosymplectic cartilage decreased size, abnormal edn1tf216b/+; plcb3th210/+ + MO1-plcb3 + MO2-plcb3 (AB) standard conditions text only from Walker et al., 2007
opercle shape, abnormal edn1tf216b/+; plcb3th210/+ + MO1-plcb3 + MO2-plcb3 (AB) standard conditions text only from Walker et al., 2007
branchiostegal ray 3 shape, abnormal edn1tf216b/+; plcb3th210/+ + MO1-plcb3 + MO2-plcb3 (AB) standard conditions text only from Walker et al., 2007
Citations