CRISPR

CRISPR1-washc3

ID

ZDB-CRISPR-260416-13

Name

CRISPR1-washc3

Previous Names

None

Target

washc3 (1)

Sequence

5' - TCTACTCCTGATCCCACAAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ulm113	washc3

Expression

Gene expression in Wild Types + CRISPR1-washc3

No data available

Phenotype

Phenotype resulting from CRISPR1-washc3

No data available

Phenotype of all Fish created by or utilizing CRISPR1-washc3

Phenotype	Fish	Conditions	Figures
whole organism decreased length, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 2 from Kim et al., 2026
heart Ab1-washc3 labeling absent, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 3 from Kim et al., 2026
heart ndufb9 expression decreased amount, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 5 from Kim et al., 2026
heart ndufa2 expression decreased amount, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 5 from Kim et al., 2026
pericardium absence of anatomical entity, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 3 from Kim et al., 2026
whole organism Ab1-washc3 labeling absent, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 2 from Kim et al., 2026
epicardium increased thickness, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 3 from Kim et al., 2026
heart cox6c expression decreased amount, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 5 from Kim et al., 2026
heart ndufs6 expression decreased amount, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 5 from Kim et al., 2026
heart acadl expression decreased amount, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 5 from Kim et al., 2026
cardiac muscle cell cellular respiration decreased process quality, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 5 from Kim et al., 2026
whole organism washc3 expression increased amount, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 2 from Kim et al., 2026
whole organism viability, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 3 from Kim et al., 2026
heart atp5f1e expression decreased amount, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 5 from Kim et al., 2026
heart acads expression decreased amount, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 5 from Kim et al., 2026
heart ndufa8 expression decreased amount, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 5 from Kim et al., 2026
epicardium tcf21 expression increased distribution, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 3 from Kim et al., 2026
heart atp5if1a expression increased amount, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 5 from Kim et al., 2026
heart pdhx expression decreased amount, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 5 from Kim et al., 2026
heart uqcrq expression decreased amount, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 5 from Kim et al., 2026
heart vdac3 expression decreased amount, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 5 from Kim et al., 2026
skeletal muscle disorganized, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 2 from Kim et al., 2026
cardiac muscle cell glycolytic process decreased process quality, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 5 from Kim et al., 2026
heart ndufs3 expression decreased amount, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 5 from Kim et al., 2026
heart me3 expression decreased amount, abnormal	washc3^{ulm113/ulm113} (AB/TU)	standard conditions	Figure 5 from Kim et al., 2026

Citations