CRISPR

CRISPR1-supt16h

ID
ZDB-CRISPR-260415-2
Name
CRISPR1-supt16h
Previous Names
None
Target
Sequence
5' - TCAGAATGAGATGACTGCTGAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
kan1 supt16h
Expression
Gene expression in Wild Types + CRISPR1-supt16h
No data available
Phenotype
Phenotype resulting from CRISPR1-supt16h
No data available
Phenotype of all Fish created by or utilizing CRISPR1-supt16h
Phenotype Fish Conditions Figures
oligodendrocyte mbpa expression decreased distribution, abnormal supt16hkan1/kan1 (AB) standard conditions Fig. 5 with image from Lee et al., 2026
whole organism olig2 expression decreased amount, abnormal supt16hkan1/kan1 (AB) control Fig. 5 with image from Lee et al., 2026
head decreased size, abnormal supt16hkan1/kan1 (AB) standard conditions Fig. 2 with image from Lee et al., 2026
whole organism decreased length, abnormal supt16hkan1/kan1 (AB) standard conditions Fig. 2 with image from Lee et al., 2026
spinal cord apoptotic process increased process quality, abnormal supt16hkan1/kan1 (AB) standard conditions Fig. 2 with image,  Fig. 4 with image from Lee et al., 2026
head decreased length, abnormal supt16hkan1/kan1 (AB) control Fig. 3 with image,  Fig. 4 with image from Lee et al., 2026
myelinating Schwann cell mbpa expression decreased distribution, abnormal supt16hkan1/kan1 (AB) standard conditions Fig. 5 with image from Lee et al., 2026
pharyngeal arch apoptotic process increased process quality, abnormal supt16hkan1/kan1 (AB) standard conditions Fig. 2 with image,  Fig. 4 with image from Lee et al., 2026
pharyngeal arch cranial neural crest cell dlx2a expression decreased distribution, abnormal supt16hkan1/kan1 (AB) standard conditions Fig. 5 with image from Lee et al., 2026
migratory neural crest cell crestin expression decreased distribution, abnormal supt16hkan1/kan1 (AB) standard conditions Fig. 5 with image from Lee et al., 2026
brain axon ab1-tuba labeling spatial pattern, abnormal supt16hkan1/kan1 (AB) standard conditions Fig. 2 with image from Lee et al., 2026
brain axon structurally discontinuous, abnormal supt16hkan1/kan1 (AB) standard conditions Fig. 2 with image from Lee et al., 2026
thigmotaxis process characteristic, abnormal supt16hkan1/kan1 (AB) control Fig. 2 with image,  Fig. 3 with image from Lee et al., 2026
whole organism dead, abnormal supt16hkan1/kan1 (AB) standard conditions text only from Lee et al., 2026
brain apoptotic process increased process quality, abnormal supt16hkan1/kan1 (AB) standard conditions Fig. 2 with image,  Fig. 4 with image from Lee et al., 2026
post-vent region kinked, abnormal supt16hkan1/kan1 (AB) standard conditions Fig. 2 with image from Lee et al., 2026
pharyngeal arch neural crest cell differentiation decreased process quality, abnormal supt16hkan1/kan1 (AB) standard conditions Fig. 5 with image from Lee et al., 2026
post-vent region curved, abnormal supt16hkan1/kan1 (AB) standard conditions Fig. 2 with image from Lee et al., 2026
ball edematous, abnormal supt16hkan1/kan1 (AB) standard conditions Fig. 2 with image from Lee et al., 2026
brain decreased size, abnormal supt16hkan1/kan1 (AB) control Fig. 3 with image from Lee et al., 2026
trunk decreased length, abnormal supt16hkan1/kan1 (AB) control Fig. 3 with image,  Fig. 4 with image from Lee et al., 2026
oligodendrocyte olig2 expression decreased distribution, abnormal supt16hkan1/kan1 (AB) standard conditions Fig. 5 with image from Lee et al., 2026
head decreased size, abnormal supt16hsd45/+; supt16hkan1/+ (AB) standard conditions Fig. 2 with image from Lee et al., 2026
whole organism decreased length, abnormal supt16hsd45/+; supt16hkan1/+ (AB) standard conditions Fig. 2 with image from Lee et al., 2026
post-vent region kinked, abnormal supt16hsd45/+; supt16hkan1/+ (AB) standard conditions Fig. 2 with image from Lee et al., 2026
post-vent region curved, abnormal supt16hsd45/+; supt16hkan1/+ (AB) standard conditions Fig. 2 with image from Lee et al., 2026
ball edematous, abnormal supt16hsd45/+; supt16hkan1/+ (AB) standard conditions Fig. 2 with image from Lee et al., 2026
head length, ameliorated supt16hkan1/kan1 + MO4-tp53 (AB) control Fig. 4 with image from Lee et al., 2026
pharyngeal arch apoptotic process process characteristic, ameliorated supt16hkan1/kan1 + MO4-tp53 (AB) control Fig. 4 with image from Lee et al., 2026
trunk decreased length, abnormal supt16hkan1/kan1 + MO4-tp53 (AB) control Fig. 4 with image from Lee et al., 2026
brain apoptotic process process characteristic, ameliorated supt16hkan1/kan1 + MO4-tp53 (AB) control Fig. 4 with image from Lee et al., 2026
spinal cord apoptotic process process characteristic, ameliorated supt16hkan1/kan1 + MO4-tp53 (AB) control Fig. 4 with image from Lee et al., 2026
Citations