CRISPR

CRISPR5-lrrc8ab

ID
ZDB-CRISPR-260212-2
Name
CRISPR5-lrrc8ab
Previous Names
None
Target
Sequence
5' - GAGAGAGCTCTTGTGGTCCACGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
twu0422 lrrc8ab
Expression
Gene expression in Wild Types + CRISPR5-lrrc8ab
No data available
Phenotype
Phenotype resulting from CRISPR5-lrrc8ab
No data available
Phenotype of all Fish created by or utilizing CRISPR5-lrrc8ab
Phenotype Fish Conditions Figures
tectal ventricle decreased volume, abnormal lrrc8abtwu0422/twu0422 + MO3-lrrc8aa + MO4-lrrc8aa (AB) standard conditions FIGURE 1 with image from Tseng et al., 2025
third ventricle decreased volume, abnormal lrrc8abtwu0422/twu0422 + MO3-lrrc8aa + MO4-lrrc8aa (AB) standard conditions FIGURE 1 with image from Tseng et al., 2025
dorsal aorta decreased diameter, abnormal lrrc8aatwu0421/+; lrrc8abtwu0422/+ (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
posterior cardinal vein decreased diameter, abnormal lrrc8aatwu0421/+; lrrc8abtwu0422/+ (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
heart contraction increased frequency, abnormal lrrc8aatwu0421/+; lrrc8abtwu0422/+ (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
dorsal longitudinal anastomotic vessel blood vessel development delayed, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/+; y1Tg (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
intersegmental vessel blood vessel development delayed, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/+; y1Tg (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
common cardinal vein blood vessel development delayed, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/+; y1Tg (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
common cardinal vein decreased length, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/+; y1Tg (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
whole organism myh6 expression decreased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
posterior cardinal vein decreased diameter, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
whole organism amotl2a expression increased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
posterior cardinal vein decreased diameter, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) chemical treatment by environment: nifedipine FIGURE 4 with image from Tseng et al., 2025
intersegmental vessel blood circulation decreased rate, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
dorsal aorta blood circulation decreased rate, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
whole organism prox1a expression decreased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
whole organism vegfc expression decreased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
common cardinal vein mrc1a expression decreased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
whole organism flt4 expression decreased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
intersegmental vessel blood circulation decreased rate, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) chemical treatment by environment: nifedipine FIGURE 4 with image from Tseng et al., 2025
whole organism prox1a expression increased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
whole organism egfl7 expression decreased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
whole organism myh6 expression increased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
whole organism myh7 expression increased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
heart contraction decreased frequency, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
dorsal aorta decreased diameter, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
dorsal aorta decreased diameter, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) chemical treatment by environment: nifedipine FIGURE 4 with image from Tseng et al., 2025
heart contraction decreased frequency, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) chemical treatment by environment: nifedipine FIGURE 4 with image from Tseng et al., 2025
whole organism cldn5b expression increased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
blood circulation decreased occurrence, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
whole organism klf2a expression decreased amount, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 5 with image from Tseng et al., 2025
intersegmental vessel branching involved in blood vessel morphogenesis disrupted, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
heart contraction increased frequency, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) standard conditions FIGURE 3 with image from Tseng et al., 2025
dorsal aorta blood circulation decreased rate, abnormal lrrc8aatwu0421/twu0421; lrrc8abtwu0422/twu0422 (AB) chemical treatment by environment: nifedipine FIGURE 4 with image from Tseng et al., 2025
dorsal aorta decreased diameter, abnormal lrrc8aatwu0421/+; lrrc8abtwu0422/+ + CRISPR1-cysltr1 + CRISPR2-cysltr1 (AB) standard conditions FIGURE 7 with image from Tseng et al., 2025
Citations