CRISPR

CRISPR2-fzd9b

ID

ZDB-CRISPR-251210-12

Name

CRISPR2-fzd9b

Previous Names

None

Target

fzd9b (1)

Sequence

5' - ACAGCCATACTCCACCAGAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
qm5	fzd9b
qm6	fzd9b

Expression

Gene expression in Wild Types + CRISPR2-fzd9b

No data available

Phenotype

Phenotype resulting from CRISPR2-fzd9b

No data available

Phenotype of all Fish created by or utilizing CRISPR2-fzd9b

Phenotype	Fish	Conditions	Figures
motor neuron axon increased branchiness, abnormal	fzd9b^qm5/qm5 (TU)	standard conditions	Fig. S1 from Torres-Perez et al., 2026
post-vent region intermediate cell mass of mesoderm myb expression decreased distribution, abnormal	fzd9b^qm5/qm5 (TU)	standard conditions	Fig. S1 from Torres-Perez et al., 2026
locomotory exploration behavior decreased process quality, abnormal	fzd9b^qm6/qm6 (TU)	control	Fig. 3 from Torres-Perez et al., 2026
whole organism tafa5l expression increased amount, abnormal	fzd9b^qm6/qm6 (TU)	standard conditions	Fig. 1 from Torres-Perez et al., 2026
whole organism nr3c2 expression increased amount, abnormal	fzd9b^qm6/qm6 (TU)	standard conditions	Fig. 2 from Torres-Perez et al., 2026
whole organism axin2 expression increased amount, abnormal	fzd9b^qm6/qm6 (TU)	standard conditions	Fig. 4 from Torres-Perez et al., 2026
whole organism wnt5b expression increased amount, abnormal	fzd9b^qm6/qm6 (TU)	standard conditions	Fig. 1 from Torres-Perez et al., 2026
motor neuron axon increased branchiness, abnormal	fzd9b^qm6/qm6 (TU)	standard conditions	Fig. 1 from Torres-Perez et al., 2026
habituation decreased process quality, abnormal	fzd9b^qm6/qm6 (TU)	vibration, visible light	Fig. 2 from Torres-Perez et al., 2026
whole organism fzd7a expression increased amount, abnormal	fzd9b^qm6/qm6 (TU)	standard conditions	Fig. 4 from Torres-Perez et al., 2026
whole organism ctnnb1 expression increased amount, abnormal	fzd9b^qm6/qm6 (TU)	standard conditions	Fig. 4 from Torres-Perez et al., 2026
post-vent region intermediate cell mass of mesoderm myb expression decreased distribution, abnormal	fzd9b^qm6/qm6 (TU)	standard conditions	Fig. 1 from Torres-Perez et al., 2026
whole organism crhb expression increased amount, abnormal	fzd9b^qm6/qm6 (TU)	standard conditions	Fig. 2 from Torres-Perez et al., 2026
whole organism fzd8a expression increased amount, abnormal	fzd9b^qm6/qm6 (TU)	standard conditions	Fig. 4 from Torres-Perez et al., 2026
whole organism fzd9a expression decreased amount, abnormal	fzd9b^qm6/qm6 (TU)	standard conditions	Fig. 4 from Torres-Perez et al., 2026
whole organism sfrp2 expression increased amount, abnormal	fzd9b^qm6/qm6 (TU)	standard conditions	Fig. 4 from Torres-Perez et al., 2026
whole organism tafa5l expression increased amount, abnormal	fzd9b^qm5/+ (TU)	standard conditions	Fig. S1 from Torres-Perez et al., 2026
whole organism wnt5b expression increased amount, abnormal	fzd9b^qm5/+ (TU)	standard conditions	Fig. S1 from Torres-Perez et al., 2026
whole organism fzd9b expression increased amount, abnormal	fzd9b^qm5/+ (TU)	standard conditions	Fig. S1 from Torres-Perez et al., 2026
post-vent region intermediate cell mass of mesoderm myb expression decreased distribution, abnormal	fzd9b^qm5/+ (TU)	standard conditions	Fig. S1 from Torres-Perez et al., 2026
whole organism scn4ab expression increased amount, abnormal	fzd9b^qm5/+ (TU)	standard conditions	Fig. S1 from Torres-Perez et al., 2026
whole organism axin2 expression increased amount, abnormal	fzd9b^qm6/+ (TU)	standard conditions	Fig. 4 from Torres-Perez et al., 2026
whole organism fzd8b expression increased amount, abnormal	fzd9b^qm6/+ (TU)	standard conditions	Fig. 4 from Torres-Perez et al., 2026
locomotory exploration behavior decreased process quality, abnormal	fzd9b^qm6/+ (TU)	control	Fig. 3 from Torres-Perez et al., 2026
whole organism fzd9b expression increased amount, abnormal	fzd9b^qm6/+ (TU)	standard conditions	Fig. 1 from Torres-Perez et al., 2026
post-vent region intermediate cell mass of mesoderm myb expression decreased distribution, abnormal	fzd9b^qm6/+ (TU)	standard conditions	Fig. 1 from Torres-Perez et al., 2026
whole organism ctnnb2 expression decreased amount, abnormal	fzd9b^qm6/+ (TU)	standard conditions	Fig. 4 from Torres-Perez et al., 2026
whole organism crhb expression increased amount, abnormal	fzd9b^qm6/+ (TU)	standard conditions	Fig. 2 from Torres-Perez et al., 2026
whole organism fzd8a expression increased amount, abnormal	fzd9b^qm6/+ (TU)	standard conditions	Fig. 4 from Torres-Perez et al., 2026
whole organism fzd9a expression decreased amount, abnormal	fzd9b^qm6/+ (TU)	standard conditions	Fig. 4 from Torres-Perez et al., 2026
whole organism nr3c2 expression increased amount, abnormal	fzd9b^qm6/+ (TU)	standard conditions	Fig. 2 from Torres-Perez et al., 2026

Citations