CRISPR

CRISPR2-adamtsl4

ID
ZDB-CRISPR-251027-2
Name
CRISPR2-adamtsl4
Previous Names
None
Target
Sequence
5' - TATCCTCCTAATGAACCATA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ucl6 adamtsl4
Expression
Gene expression in Wild Types + CRISPR2-adamtsl4
No data available
Phenotype
Phenotype resulting from CRISPR2-adamtsl4
No data available
Phenotype of all Fish created by or utilizing CRISPR2-adamtsl4
Phenotype Fish Conditions Figures
annular ligament inclusion compound increased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 8 with image from Tevar et al., 2025
pupil ventral side elongated, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 6 with image from Tevar et al., 2025
corneal epithelium superficial side swollen, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 7 with imageFig. 8 with image from Tevar et al., 2025
whole organism smc1a expression increased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
whole organism opn1mw1 expression decreased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
eye decreased size, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 3 with image from Tevar et al., 2025
whole organism guca1ab.1 expression increased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
corneal epithelium swollen, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 3 with imageFig. 4 with image from Tevar et al., 2025
retinal outer plexiform layer Ab1-adamtsl4 labeling absent, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Figure 3 with image from Tevar et al., 2024
lens epithelium increased distance lens fiber cell, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 3 with imageFig. 4 with image from Tevar et al., 2025
iridophore guanine increased distribution, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 4 with imageFig. 8 with image from Tevar et al., 2025
whole organism dnase1l1l expression decreased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
periocular mesenchyme Ab1-adamtsl4 labeling absent, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Figure 3 with image from Tevar et al., 2024
swim bladder uninflated, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 2 with image from Tevar et al., 2025
whole organism mgst2 expression decreased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
whole organism mmp13a.2 expression increased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
inter-frontal joint irregularly shaped, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 5 with image from Tevar et al., 2025
whole organism adamtsl4 expression decreased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 1 with image from Tevar et al., 2025
annular ligament adaxial-abaxial axis extends to cornea ventral side, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 7 with image from Tevar et al., 2025
pericardium edematous, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 2 with image from Tevar et al., 2025
lens epithelium Ab1-adamtsl4 labeling absent, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Figure 3 with image from Tevar et al., 2024
pupil decreased ratio eye, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 2 with image from Tevar et al., 2025
anterior chamber eye decreased volume, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 6 with image from Tevar et al., 2025
corneal endothelium spatial pattern, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 4 with image from Tevar et al., 2025
optokinetic behavior decreased process quality, abnormal adamtsl4ucl6/ucl6 (AB) control Fig. 9 with image from Tevar et al., 2025
retinal pigmented epithelium increased distance retinal neural layer, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 4 with image from Tevar et al., 2025
whole organism lamb1a expression increased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
whole organism opn1lw2 expression decreased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
whole organism col10a1a expression increased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
corneal stroma collagen trimer disorganized, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 4 with imageFig. 8 with image from Tevar et al., 2025
whole organism mmp9 expression decreased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
corneal epithelium stratification, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 3 with imageFig. 4 with image from Tevar et al., 2025
corneal endothelium stratification, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 4 with image from Tevar et al., 2025
corneal endothelium swollen, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 4 with image from Tevar et al., 2025
cornea increased thickness, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 7 with image from Tevar et al., 2025
lens fiber cell increased ratio lens capsule, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 6 with image from Tevar et al., 2025
cornea Ab1-adamtsl4 labeling absent, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Figure 3 with image from Tevar et al., 2024
whole organism adam8a expression increased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
whole organism tdh2 expression decreased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
whole organism crybgx expression decreased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
whole organism lamb2 expression increased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
iridophore guanine disorganized, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 8 with image from Tevar et al., 2025
whole organism foxo1b expression decreased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
eye xanthophore increased size, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 4 with image from Tevar et al., 2025
whole organism plin2 expression increased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
frontal-parietal joint irregularly shaped, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 5 with image from Tevar et al., 2025
whole organism mcm6 expression decreased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
frontal bone morphology, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 5 with image from Tevar et al., 2025
retinal pigmented epithelium increased size, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 3 with image from Tevar et al., 2025
anterior chamber eye xanthophore morphology, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 3 with image from Tevar et al., 2025
iridophore guanine crystal configuration, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 4 with imageFig. 8 with image from Tevar et al., 2025
corneal epithelium spatial pattern, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 3 with imageFig. 4 with image from Tevar et al., 2025
pupil increased ratio eye, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 2 with image from Tevar et al., 2025
corneal epithelium increased thickness, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 7 with image from Tevar et al., 2025
whole organism krt1-19e expression increased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
iris melanophore layer increased distance retinal neural layer, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 8 with image from Tevar et al., 2025
whole organism cryba4 expression decreased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
whole organism il1b expression decreased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
lens capsule increased thickness, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 4 with image from Tevar et al., 2025
whole organism timp2b expression increased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
whole organism fn1a expression increased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
retinal inner plexiform layer Ab1-adamtsl4 labeling absent, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Figure 3 with image from Tevar et al., 2024
lens fiber cell increased distance lens fiber cell, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 7 with imageFig. 8 with image from Tevar et al., 2025
whole organism lamc2 expression decreased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
anterior chamber eye lens decreased volume, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 6 with image from Tevar et al., 2025
lens fiber cell gap junction structure, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 8 with image from Tevar et al., 2025
whole organism itga6b expression decreased amount, abnormal adamtsl4ucl6/ucl6 (AB) standard conditions Fig. 10 with image from Tevar et al., 2025
whole organism adamtsl4 expression decreased amount, abnormal adamtsl4ucl6/+ (AB) standard conditions Fig. 1 with image from Tevar et al., 2025
anterior chamber eye lens decreased volume, abnormal adamtsl4ucl6/+; cpamd8ucl5/+ (AB) standard conditions Figure 7 with image from Tevar et al., 2024
anterior chamber eye decreased volume, abnormal adamtsl4ucl6/+; cpamd8ucl5/+ (AB) standard conditions Figure 7 with image from Tevar et al., 2024
Citations