CRISPR

CRISPR1-adamtsl4

ID

ZDB-CRISPR-251027-1

Name

CRISPR1-adamtsl4

Previous Names

None

Target

adamtsl4 (1)

Sequence

5' - GATGGTCTATTCCATGTAAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ucl6	adamtsl4

Expression

Gene expression in Wild Types + CRISPR1-adamtsl4

No data available

Phenotype

Phenotype resulting from CRISPR1-adamtsl4

No data available

Phenotype of all Fish created by or utilizing CRISPR1-adamtsl4

Phenotype	Fish	Conditions	Figures
annular ligament inclusion compound increased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 8 from Tevar et al., 2025
pupil ventral side elongated, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 6 from Tevar et al., 2025
corneal epithelium superficial side swollen, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 7 , Fig. 8 from Tevar et al., 2025
whole organism smc1a expression increased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
whole organism opn1mw1 expression decreased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
eye decreased size, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 3 from Tevar et al., 2025
whole organism guca1ab.1 expression increased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
corneal epithelium swollen, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 3 , Fig. 4 from Tevar et al., 2025
retinal outer plexiform layer Ab1-adamtsl4 labeling absent, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Figure 3 from Tevar et al., 2024
lens epithelium increased distance lens fiber cell, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 3 , Fig. 4 from Tevar et al., 2025
iridophore guanine increased distribution, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 4 , Fig. 8 from Tevar et al., 2025
whole organism dnase1l1l expression decreased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
periocular mesenchyme Ab1-adamtsl4 labeling absent, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Figure 3 from Tevar et al., 2024
swim bladder uninflated, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 2 from Tevar et al., 2025
whole organism mgst2 expression decreased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
whole organism mmp13a.2 expression increased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
inter-frontal joint irregularly shaped, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 5 from Tevar et al., 2025
whole organism adamtsl4 expression decreased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 1 from Tevar et al., 2025
annular ligament adaxial-abaxial axis extends to cornea ventral side, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 7 from Tevar et al., 2025
pericardium edematous, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 2 from Tevar et al., 2025
lens epithelium Ab1-adamtsl4 labeling absent, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Figure 3 from Tevar et al., 2024
pupil decreased ratio eye, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 2 from Tevar et al., 2025
anterior chamber eye decreased volume, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 6 from Tevar et al., 2025
corneal endothelium spatial pattern, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 4 from Tevar et al., 2025
optokinetic behavior decreased process quality, abnormal	adamtsl4^ucl6/ucl6 (AB)	control	Fig. 9 from Tevar et al., 2025
retinal pigmented epithelium increased distance retinal neural layer, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 4 from Tevar et al., 2025
whole organism lamb1a expression increased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
whole organism opn1lw2 expression decreased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
whole organism col10a1a expression increased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
corneal stroma collagen trimer disorganized, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 4 , Fig. 8 from Tevar et al., 2025
whole organism mmp9 expression decreased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
corneal epithelium stratification, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 3 , Fig. 4 from Tevar et al., 2025
corneal endothelium stratification, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 4 from Tevar et al., 2025
corneal endothelium swollen, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 4 from Tevar et al., 2025
cornea increased thickness, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 7 from Tevar et al., 2025
lens fiber cell increased ratio lens capsule, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 6 from Tevar et al., 2025
cornea Ab1-adamtsl4 labeling absent, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Figure 3 from Tevar et al., 2024
whole organism adam8a expression increased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
whole organism tdh2 expression decreased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
whole organism crybgx expression decreased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
whole organism lamb2 expression increased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
iridophore guanine disorganized, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 8 from Tevar et al., 2025
whole organism foxo1b expression decreased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
eye xanthophore increased size, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 4 from Tevar et al., 2025
whole organism plin2 expression increased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
frontal-parietal joint irregularly shaped, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 5 from Tevar et al., 2025
whole organism mcm6 expression decreased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
frontal bone morphology, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 5 from Tevar et al., 2025
retinal pigmented epithelium increased size, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 3 from Tevar et al., 2025
anterior chamber eye xanthophore morphology, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 3 from Tevar et al., 2025
iridophore guanine crystal configuration, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 4 , Fig. 8 from Tevar et al., 2025
corneal epithelium spatial pattern, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 3 , Fig. 4 from Tevar et al., 2025
pupil increased ratio eye, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 2 from Tevar et al., 2025
corneal epithelium increased thickness, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 7 from Tevar et al., 2025
whole organism krt1-19e expression increased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
iris melanophore layer increased distance retinal neural layer, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 8 from Tevar et al., 2025
whole organism cryba4 expression decreased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
whole organism il1b expression decreased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
lens capsule increased thickness, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 4 from Tevar et al., 2025
whole organism timp2b expression increased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
whole organism fn1a expression increased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
retinal inner plexiform layer Ab1-adamtsl4 labeling absent, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Figure 3 from Tevar et al., 2024
lens fiber cell increased distance lens fiber cell, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 7 , Fig. 8 from Tevar et al., 2025
whole organism lamc2 expression decreased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
anterior chamber eye lens decreased volume, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 6 from Tevar et al., 2025
lens fiber cell gap junction structure, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 8 from Tevar et al., 2025
whole organism itga6b expression decreased amount, abnormal	adamtsl4^ucl6/ucl6 (AB)	standard conditions	Fig. 10 from Tevar et al., 2025
whole organism adamtsl4 expression decreased amount, abnormal	adamtsl4^ucl6/+ (AB)	standard conditions	Fig. 1 from Tevar et al., 2025
anterior chamber eye lens decreased volume, abnormal	adamtsl4^ucl6/+; cpamd8^ucl5/+ (AB)	standard conditions	Figure 7 from Tevar et al., 2024
anterior chamber eye decreased volume, abnormal	adamtsl4^ucl6/+; cpamd8^ucl5/+ (AB)	standard conditions	Figure 7 from Tevar et al., 2024

Citations