CRISPR

CRISPR4-tfeb

ID

ZDB-CRISPR-250911-3

Name

CRISPR4-tfeb

Previous Names

None

Target

tfeb (1)

Sequence

5' - GGCGTTGGTTTTGGGGATCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The first two "G"s were added.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
hg152	tfeb

Expression

Gene expression in Wild Types + CRISPR4-tfeb

No data available

Phenotype

Phenotype resulting from CRISPR4-tfeb

No data available

Phenotype of all Fish created by or utilizing CRISPR4-tfeb

Phenotype	Fish	Conditions	Figures
liver glucose decreased amount, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	standard conditions	Fig 5 from Rissone et al., 2025
whole organism dead, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	chemical treatment by environment: sodium arsenite	Fig 7 from Rissone et al., 2025
retina apoptotic, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	standard conditions	Fig. S1 from Rissone et al., 2025
whole organism tfeb expression decreased amount, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	standard conditions	Fig 1 from Rissone et al., 2025
female organism increased length, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	standard conditions	Fig 1 from Rissone et al., 2025
gut epithelium microvillus decreased mass density, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	standard conditions	Fig 5 from Rissone et al., 2025
oocyte stage V absent, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	standard conditions	Fig 1 from Rissone et al., 2025
brain apoptotic, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	standard conditions	Fig. S1 from Rissone et al., 2025
left liver lobe cell population proliferation disrupted, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	standard conditions	Fig 5 from Rissone et al., 2025
liver glycogen decreased amount, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	standard conditions	Fig 5 from Rissone et al., 2025
whole organism dead, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	heat shock	Fig 7 from Rissone et al., 2025
whole organism increased sensitivity toward whole organism sodium arsenite, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	chemical treatment by environment: sodium arsenite	Fig 7 from Rissone et al., 2025
whole organism dead, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	standard conditions	Fig 1 from Rissone et al., 2025
cellular response to temperature stimulus disrupted, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	heat shock	Fig 7 from Rissone et al., 2025
whole organism dead, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	standard conditions	Fig 1 from Rissone et al., 2025
pancreas decreased size, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	standard conditions	Fig 2 from Rissone et al., 2025
male organism decreased length, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	standard conditions	Fig 1 from Rissone et al., 2025
male organism decreased size, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	standard conditions	Fig 1 from Rissone et al., 2025
response to sodium arsenite increased magnitude, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	chemical treatment by environment: sodium arsenite	Fig 7 from Rissone et al., 2025
liver fabp10a expression decreased amount, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	standard conditions	Fig 2 from Rissone et al., 2025
pancreatic acinar cell zymogen granule decreased amount, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	standard conditions	Fig 2 from Rissone et al., 2025
whole organism tfe3a expression decreased amount, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	standard conditions	Fig 1 from Rissone et al., 2025
exocrine pancreas ins expression decreased amount, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154	standard conditions	Fig 2 from Rissone et al., 2025
pancreas endoplasmic reticulum dilated, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154; jh1Tg	standard conditions	Fig 3 from Rissone et al., 2025
pancreatic acinar cell zymogen granule decreased diameter, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154; jh1Tg	standard conditions	Fig 3 from Rissone et al., 2025
pancreas nuclear envelope dilated, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154; jh1Tg	standard conditions	Fig 3 from Rissone et al., 2025
pancreas edematous, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154; jh1Tg	standard conditions	Fig 3 from Rissone et al., 2025
pancreas zymogen granule membrane ruptured, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154; jh1Tg	standard conditions	Fig 3 from Rissone et al., 2025
pancreas inflamed, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154; jh1Tg	standard conditions	Fig 3 from Rissone et al., 2025
pancreas decreased size, abnormal	tfe3a^hg153/hg153; tfeb^hg151/hg151; tfeb^hg152/hg152; tfe3b^hg154/hg154; jh1Tg	standard conditions	Fig 3 from Rissone et al., 2025

Citations