CRISPR

CRISPR3-tfeb

ID
ZDB-CRISPR-250911-2
Name
CRISPR3-tfeb
Previous Names
None
Target
Sequence
5' - GGTGCCTGTTGAAGTGCTAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
hg151 tfeb
Expression
Gene expression in Wild Types + CRISPR3-tfeb
No data available
Phenotype
Phenotype resulting from CRISPR3-tfeb
No data available
Phenotype of all Fish created by or utilizing CRISPR3-tfeb
Phenotype Fish Conditions Figures
liver glucose decreased amount, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 standard conditions Fig 5 with image from Rissone et al., 2025
whole organism dead, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 chemical treatment by environment: sodium arsenite Fig 7 with image from Rissone et al., 2025
retina apoptotic, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 standard conditions Fig. S1 from Rissone et al., 2025
whole organism tfeb expression decreased amount, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 standard conditions Fig 1 with image from Rissone et al., 2025
female organism increased length, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 standard conditions Fig 1 with image from Rissone et al., 2025
gut epithelium microvillus decreased mass density, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 standard conditions Fig 5 with image from Rissone et al., 2025
oocyte stage V absent, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 standard conditions Fig 1 with image from Rissone et al., 2025
brain apoptotic, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 standard conditions Fig. S1 from Rissone et al., 2025
left liver lobe cell population proliferation disrupted, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 standard conditions Fig 5 with image from Rissone et al., 2025
liver glycogen decreased amount, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 standard conditions Fig 5 with image from Rissone et al., 2025
whole organism dead, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 heat shock Fig 7 with image from Rissone et al., 2025
whole organism increased sensitivity toward whole organism sodium arsenite, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 chemical treatment by environment: sodium arsenite Fig 7 with image from Rissone et al., 2025
whole organism dead, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 standard conditions Fig 1 with image from Rissone et al., 2025
cellular response to temperature stimulus disrupted, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 heat shock Fig 7 with image from Rissone et al., 2025
whole organism dead, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 standard conditions Fig 1 with image from Rissone et al., 2025
pancreas decreased size, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 standard conditions Fig 2 with image from Rissone et al., 2025
male organism decreased length, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 standard conditions Fig 1 with image from Rissone et al., 2025
male organism decreased size, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 standard conditions Fig 1 with image from Rissone et al., 2025
response to sodium arsenite increased magnitude, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 chemical treatment by environment: sodium arsenite Fig 7 with image from Rissone et al., 2025
liver fabp10a expression decreased amount, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 standard conditions Fig 2 with image from Rissone et al., 2025
pancreatic acinar cell zymogen granule decreased amount, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 standard conditions Fig 2 with image from Rissone et al., 2025
whole organism tfe3a expression decreased amount, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 standard conditions Fig 1 with image from Rissone et al., 2025
exocrine pancreas ins expression decreased amount, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154 standard conditions Fig 2 with image from Rissone et al., 2025
pancreas endoplasmic reticulum dilated, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154; jh1Tg standard conditions Fig 3 with image from Rissone et al., 2025
pancreatic acinar cell zymogen granule decreased diameter, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154; jh1Tg standard conditions Fig 3 with image from Rissone et al., 2025
pancreas nuclear envelope dilated, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154; jh1Tg standard conditions Fig 3 with image from Rissone et al., 2025
pancreas edematous, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154; jh1Tg standard conditions Fig 3 with image from Rissone et al., 2025
pancreas zymogen granule membrane ruptured, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154; jh1Tg standard conditions Fig 3 with image from Rissone et al., 2025
pancreas inflamed, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154; jh1Tg standard conditions Fig 3 with image from Rissone et al., 2025
pancreas decreased size, abnormal tfe3ahg153/hg153; tfebhg151/hg151; tfebhg152/hg152; tfe3bhg154/hg154; jh1Tg standard conditions Fig 3 with image from Rissone et al., 2025
Citations