CRISPR

CRISPR1-alpl

ID
ZDB-CRISPR-250731-2
Name
CRISPR1-alpl
Previous Names
None
Target
Sequence
5' - GGTGACCTCGTTCCCCTGAG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf4270 alpl
Expression
Gene expression in Wild Types + CRISPR1-alpl
No data available
Phenotype
Phenotype resulting from CRISPR1-alpl
No data available
Phenotype of all Fish created by or utilizing CRISPR1-alpl
Phenotype Fish Conditions Figures
whole organism (R)-adrenaline decreased amount, abnormal alplzf4270/zf4270 (TL) control Figure 6 with image from Ciapaite et al., 2025
whole organism mobility, ameliorated alplzf4270/zf4270 (TL) chemical treatment by environment: pyridoxine Figure 6 with image from Ciapaite et al., 2025
locomotory behavior process quality, ameliorated alplzf4270/zf4270 (TL) chemical treatment by environment: pyridoxine Figure 4 with image from Ciapaite et al., 2025
whole organism 2-[3-carboxy-3-(methylammonio)propyl]-L-histidine decreased amount, abnormal alplzf4270/zf4270 (TL) control Figure 6 with image from Ciapaite et al., 2025
vitamin B6 metabolic process process quality, ameliorated alplzf4270/zf4270 (TL) chemical treatment by environment: pyridoxine Figure 4 with image from Ciapaite et al., 2025
polyamine biosynthetic process process quality, abnormal alplzf4270/zf4270 (TL) control Figure 6 with image from Ciapaite et al., 2025
whole organism gamma-aminobutyric acid amount, ameliorated alplzf4270/zf4270 (TL) chemical treatment by environment: pyridoxine Figure 4 with image,  Figure 6 with image from Ciapaite et al., 2025
whole organism bone mineralization decreased occurrence, abnormal alplzf4270/zf4270 (TL) standard conditions Figure 2 with image from Ciapaite et al., 2025
whole organism decreased life span, ameliorated alplzf4270/zf4270 (TL) chemical treatment by environment: pyridoxine Figure 6 with image from Ciapaite et al., 2025
whole organism 4-pyridoxic acid decreased amount, abnormal alplzf4270/zf4270 (TL) standard conditions Figure 2 with image from Ciapaite et al., 2025
whole organism methionine increased amount, abnormal alplzf4270/zf4270 (TL) control Figure 4 with image from Ciapaite et al., 2025
whole organism alpl expression absent, abnormal alplzf4270/zf4270 (TL) standard conditions Figure 1 with image from Ciapaite et al., 2025
whole organism decreased life span, abnormal alplzf4270/zf4270 (TL) control Figure 6 with image from Ciapaite et al., 2025
whole organism N-methylethanolaminium phosphate(1-) increased amount, abnormal alplzf4270/zf4270 (TL) control Figure 6 with image from Ciapaite et al., 2025
whole organism asparagine amount, ameliorated alplzf4270/zf4270 (TL) chemical treatment by environment: pyridoxine Figure 4 with image from Ciapaite et al., 2025
whole organism methionine amount, ameliorated alplzf4270/zf4270 (TL) chemical treatment by environment: pyridoxine Figure 4 with image from Ciapaite et al., 2025
whole organism glutamine amount, ameliorated alplzf4270/zf4270 (TL) chemical treatment by environment: pyridoxine Figure 4 with image from Ciapaite et al., 2025
locomotory behavior process quality, abnormal alplzf4270/zf4270 (TL) standard conditions Figure 3 with image,  Figure 4 with image from Ciapaite et al., 2025
whole organism Vanillactic acid increased amount, abnormal alplzf4270/zf4270 (TL) control Figure 6 with image from Ciapaite et al., 2025
whole organism pyridoxal decreased amount, abnormal alplzf4270/zf4270 (TL) standard conditions Figure 2 with image from Ciapaite et al., 2025
whole organism decreased mobility, abnormal alplzf4270/zf4270 (TL) control Figure 6 with image from Ciapaite et al., 2025
whole organism gamma-aminobutyric acid decreased amount, abnormal alplzf4270/zf4270 (TL) control Figure 4 with image,  Figure 6 with image from Ciapaite et al., 2025
whole organism retinal decreased amount, abnormal alplzf4270/zf4270 (TL) control Figure 6 with image from Ciapaite et al., 2025
vitamin B6 metabolic process process quality, abnormal alplzf4270/zf4270 (TL) standard conditions Figure 2 with image,  Figure 4 with image from Ciapaite et al., 2025
whole organism asparagine decreased amount, abnormal alplzf4270/zf4270 (TL) control Figure 4 with image from Ciapaite et al., 2025
whole organism glutamine decreased amount, abnormal alplzf4270/zf4270 (TL) control Figure 4 with image from Ciapaite et al., 2025
whole organism alkaline phosphatase activity decreased magnitude, abnormal alplzf4270/zf4270 (TL) standard conditions Figure 1 with image from Ciapaite et al., 2025
whole organism L-dopa increased amount, abnormal alplzf4270/zf4270 (TL) control Figure 6 with image from Ciapaite et al., 2025
phenylalanine decarboxylase activity process quality, abnormal alplzf4270/zf4270 (TL) control Figure 6 with image from Ciapaite et al., 2025
whole organism pyridoxal 5'-phosphate decreased amount, abnormal alplzf4270/zf4270 (TL) standard conditions Figure 2 with image from Ciapaite et al., 2025
whole organism retinol increased amount, abnormal alplzf4270/zf4270 (TL) control Figure 6 with image from Ciapaite et al., 2025
whole organism alkaline phosphatase activity decreased magnitude, abnormal alplzf4270/+ (TL) standard conditions Figure 1 with image from Ciapaite et al., 2025
whole organism alpl expression decreased amount, abnormal alplzf4270/+ (TL) standard conditions Figure 1 with image from Ciapaite et al., 2025
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.