CRISPR

CRISPR4-sqstm1

ID
ZDB-CRISPR-250708-3
Name
CRISPR4-sqstm1
Previous Names
None
Target
Sequence
5' - GACAGAGACTCCACCAGCCT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf4282 sqstm1
Expression
Gene expression in Wild Types + CRISPR4-sqstm1
No data available
Phenotype
Phenotype resulting from CRISPR4-sqstm1
No data available
Phenotype of all Fish created by or utilizing CRISPR4-sqstm1
Phenotype Fish Conditions Figures
vertebral column bone mineralization occurrence, abnormal sqstm1zf4282/zf4282 (AB) standard conditions Fig. 3 with image from Huybrechts et al., 2025
vertebra malformed, abnormal sqstm1zf4282/zf4282 (AB) standard conditions Fig. 3 with image from Huybrechts et al., 2025
vertebral column mass density, abnormal sqstm1zf4282/zf4282 (AB) standard conditions Fig. 3 with image from Huybrechts et al., 2025
scale shape, abnormal sqstm1zf4282/zf4282 (AB) standard conditions Fig. 6 with image from Huybrechts et al., 2025
whole organism hemorrhagic, abnormal sqstm1zf4282/zf4282 (AB) standard conditions Fig. 2 with image from Huybrechts et al., 2025
vertebral column has extra parts of type bone element, abnormal sqstm1zf4282/zf4282 (AB) standard conditions Fig. 3 with image from Huybrechts et al., 2025
whole organism low saturation, abnormal sqstm1zf4282/zf4282 (AB) standard conditions Fig. 2 with image from Huybrechts et al., 2025
osteocyte lacuna increased size, abnormal sqstm1zf4282/zf4282 (AB) standard conditions Fig. 5 with image from Huybrechts et al., 2025
whole organism decreased life span, abnormal sqstm1zf4282/zf4282 (AB) standard conditions text only from Huybrechts et al., 2025
scale bone resorption increased occurrence, abnormal sqstm1zf4282/zf4282 (AB) standard conditions Fig. 6 with image from Huybrechts et al., 2025
vertebral column structure, abnormal sqstm1zf4282/zf4282 (AB) standard conditions Fig. 3 with image from Huybrechts et al., 2025
hemal arch decreased thickness, abnormal sqstm1zf4282/+ (AB) standard conditions Fig. 4 with image from Huybrechts et al., 2025
neural spine decreased thickness, abnormal sqstm1zf4282/+ (AB) standard conditions Fig. 4 with image from Huybrechts et al., 2025
whole organism increased weight, abnormal sqstm1zf4282/+ (AB) standard conditions Fig. 2 with image from Huybrechts et al., 2025
vertebral column structure, abnormal sqstm1zf4282/+ (AB) standard conditions Fig. 3 with image from Huybrechts et al., 2025
osteocyte lacuna increased size, abnormal sqstm1zf4282/+ (AB) standard conditions Fig. 5 with image from Huybrechts et al., 2025
neural arch decreased thickness, abnormal sqstm1zf4282/+ (AB) standard conditions Fig. 4 with image from Huybrechts et al., 2025
scale bone resorption increased occurrence, abnormal sqstm1zf4282/+ (AB) standard conditions Fig. 6 with image from Huybrechts et al., 2025
centrum increased length, abnormal sqstm1zf4282/+ (AB) standard conditions Fig. 4 with image from Huybrechts et al., 2025
Citations